Hi greekkey,
I solved the problem in the meantime by adding DMSO, BSA and Betaine.
Thank you for trying to help me though!
Best,
Anna.
-
Primers for ZCCHC24
Dear Seqanswer members,
I am desperately trying to amplify/sequence the first exon of the ZCCHC24 gene. I tried it with the following primers
Fwd 5' cgaggcagatagcggatcg 3'
Rev 5' cttggcttggcttcgttcaac 3'
with several polymerases (PeqLab Taq-DNA-Polymerase, TaKaRa rTaq, TaqOne GC Kit) at several annealing temperatures (ranging from 50°C to 60°C). I also tried to add 1 µl DMSO. I get either unspecific products (which do not contain a product of desired length) or there is no product at all.
A former employee already have tried the following primers and failed as well:
Fwd 5' aactttcgctgcctccttc 3'
Rev 5' ctgtctgacccgctcttcct 3'
I don't know which polymerases and programms she used though.
Do you have any ideas, how I could amplify/sequence this exon?
Any suggestions, including primer suggestions are appreciated!
Thank you in advance,
Anna.
-
Spatial biology is an exciting field that encompasses a wide range of techniques and technologies aimed at mapping the organization and interactions of various biomolecules in their native environments. As this area of research progresses, new tools and methodologies are being introduced, accompanied by efforts to establish benchmarking standards and drive technological innovation.
3D Genomics
While spatial biology often involves studying proteins and RNAs in their...01-01-2025, 07:30 PM -
Many organizations study rare diseases, but few have a mission as impactful as Rady Children’s Institute for Genomic Medicine (RCIGM). “We are all about changing outcomes for children,” explained Dr. Stephen Kingsmore, President and CEO of the group. The institute’s initial goal was to provide rapid diagnoses for critically ill children and shorten their diagnostic odyssey, a term used to describe the long and arduous process it takes patients to obtain an accurate...12-16-2024, 07:57 AM
Leave a comment: