why Hairspin region will affect the PCR product

[arkilis]

Hi,

I am doing a primer design recently, and using the primer 3 to do the primer design. But get a warning at the end:

CGGCGCCGAGCCCCGCCGGGGTGAGCTGGG


Which looks like a CGG Hairspin. Many people tell me that *might* cause the pcr amplification failure. But why...

Thanks in advance.

[Angelmass]

Is this the priming region or the amplicon?

Hairpins cause secondary structure loops cause DNA polymerase slippage, which can cause frameshift mutations in your sequence when undergoing PCR, which obviously you don't want.

If it's the priming region, the secondary structure loop would cause the primer to bind to your DNA inefficiently.

Either way, you would get less amplification than you were expecting. The warning I assume is to stop you from putting together a poorly designed primer.