Header Leaderboard Ad

Collapse

SAM files aligned by Bowtie - Mystified.

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • SAM files aligned by Bowtie - Mystified.

    Hi,

    This is one of my first forays in SOLID data so please bear with me if the question is basic;

    I had aligned SOLID data individually (forward, reverse) using bowtie color space -
    bowtie -t -p 4 -C --sam --chunkmbs 1000 /Bowtie-Reference/Bowtie-C/h_sapiens_37_asm_c -f read1.csfasta -Q read1.QV.qual read1.sam

    I ended up getting a sam file with what appears to me a malformed sam files;

    1_2_1079_F3 4 * 0 0 * * 0 0 CCGTGATGGCTACCCCTGGGGTTACATATAAATT *[email protected]@:@[email protected]@@@2>>@6*5=**.;.--<@=3 XM:i:0

    1_3_10_F3 0 gi|224589818|ref|NC_000006.11| 33410152 255 33M * 0 0 ATTCCCGCCTCTCCTTTCATTTGTCCACATCTC \IFIAGPMOYZL>PRAN`a/#S30FHP?J/!!' XA:i:2 MD:Z:33 NM:i:0 CM:i:4

    I kind of figured that "*" on 3rd column, "@" and some CIGAR sequence in the next line as mal-formed elements. I would very much appreciate if anyone can shed some light on this and suggest any solution to this problem.

    Thanks

    Uma

  • #2
    I am not sure I understand your question. It appears to me that your first SAM line (starting with '1_2...') is a valid line where the read does not map while your second SAM lines (starting with '1_3...') is also a valid line that represents a read that does map.

    Comment


    • #3
      Originally posted by westerman View Post
      I am not sure I understand your question. It appears to me that your first SAM line (starting with '1_2...') is a valid line where the read does not map while your second SAM lines (starting with '1_3...') is also a valid line that represents a read that does map.
      One thing I noticed is that the phred scores for the second read span too big of a range to be any of the typical formats.

      Edit: Although perhaps it's just not one I've ever seen! I had a reply similar to your written yesterday before noticing the Phred issue.

      Comment

      Latest Articles

      Collapse

      • seqadmin
        A Brief Overview and Common Challenges in Single-cell Sequencing Analysis
        by seqadmin


        ​​​​​​The introduction of single-cell sequencing has advanced the ability to study cell-to-cell heterogeneity. Its use has improved our understanding of somatic mutations1, cell lineages2, cellular diversity and regulation3, and development in multicellular organisms4. Single-cell sequencing encompasses hundreds of techniques with different approaches to studying the genomes, transcriptomes, epigenomes, and other omics of individual cells. The analysis of single-cell sequencing data i...

        01-24-2023, 01:19 PM
      • seqadmin
        Introduction to Single-Cell Sequencing
        by seqadmin
        Single-cell sequencing is a technique used to investigate the genome, transcriptome, epigenome, and other omics of individual cells using high-throughput sequencing. This technology has provided many scientific breakthroughs and continues to be applied across many fields, including microbiology, oncology, immunology, neurobiology, precision medicine, and stem cell research.

        The advancement of single-cell sequencing began in 2009 when Tang et al. investigated the single-cell transcriptomes
        ...
        01-09-2023, 03:10 PM

      ad_right_rmr

      Collapse
      Working...
      X