Header Leaderboard Ad

Collapse

SOLiD Adapters

Collapse

Announcement

Collapse
No announcement yet.
This is a sticky topic.
X
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • #16
    Is there an official download source for the updated SOLiD adaptor sequences?
    The one I am using is from the bioscope example dataset
    ./applications/wholeTranscriptome.run/.run/reads/human_filter_reference.fasta

    looking at this list I think that file which I had previously thought sufficient seems to be quite lacking!
    other than the human tRNAs and line repeats,
    it lists the 16 barcodes
    >adaptor + bc16 + P2
    and only
    >P1 adaptor.
    http://kevin-gattaca.blogspot.com/

    Comment


    • #17
      You can refer to this appendix D (page 206 onwards) of Applied Biosystems SOLiD™ 4 System Library Preparation Guide which covers:
      1. Library construction oligonucleotides
      2. Adaptor sequences
      3. Multiplex adaptor and barcode sequences

      Comment


      • #18
        Originally posted by yksikaksi View Post
        You can refer to this appendix D (page 206 onwards) of Applied Biosystems SOLiD™ 4 System Library Preparation Guide which covers:
        1. Library construction oligonucleotides
        2. Adaptor sequences
        3. Multiplex adaptor and barcode sequences
        Thank you very much. That's exactly what i want.

        Comment


        • #19
          What about adaptors used for RNA ligation in "Total RNA-Seq" kit? if I am not wrong, their sequenced are not disclosed here?
          Thanks in advance.

          Comment


          • #20
            Yeah, Ambion is playing that pretty close to their vest.

            Unfortunate because with the recent major drop in the cost of both Illumina library construction kits and vast increase in the amount of sequence produced per run, I fear the SOLiD may no longer be competitive for RNA seq.

            Reagent costs for the SOLiD RNA sequence library construction kit needs to drop down to around $50/sample. The Illumina kit is around $70/sample -- but that includes polyA isolation!

            --
            Phillip

            Comment


            • #21
              well, for the moment I am working with microRNA, i.e. don't care about polyA.
              (to tell the full story, I am trying to understand if there is a way to make miRNA->cDNA library compatible for both sequencing and qPCR - that's why my question about adapters arose)

              Comment


              • #22
                ok, finally I found by myself
                according to published patent 20100279305, adaptor oligo mix contains
                1) 5'-CCUCUCUAUGGGCAGUCGGUGAU (3.1 μM)
                2) 5'-NNNNNNATCACCGACTGCCCATAGAGAGG (6.1 μM)
                3) 5'-PO4--CGCCTTGGCCGTACAGCAG (3.1 μM)
                4) 5'-CTGCTGTACGGCCAAGGCGNNNNNN (6.1 μM)

                Comment


                • #23
                  And this is how they can be aligned to known P1 and internal adapters mentioned in post #2:

                  P1 Adapter:
                  1) 5' -------CC ACTACGCCTCCGC TTTCCTCTCTATGGGCAGTCGGTGAT
                  2) 3' -----TTGG TGATGCGGAGGCG AAAGGAGAGATACCCGTCAGCCACTA NNNNNN

                  Internal Adapter
                  3) 5' --------CGTACAtCCGCCTTGGCCGTACAGCAG
                  4) 3' ------TGGCNNNNNNGCGGAACCGGCATGTCGTC

                  Comment


                  • #24
                    Originally posted by aushev View Post
                    ok, finally I found by myself
                    according to published patent [snip]
                    While patents are a great place to look, I'd caution you that even though it's listed there doesn't mean that's what is in your current kit...!

                    Comment


                    • #25
                      Originally posted by ECO View Post
                      While patents are a great place to look, I'd caution you that even though it's listed there doesn't mean that's what is in your current kit...!
                      thanks for cautioning, I totally agree, that's why I indicated the source of data.

                      Comment


                      • #26
                        Originally posted by aushev View Post
                        [...]



                        4) 3' ------TGGCNNNNNNGCGGAACCGGCATGTCGTC
                        Where does the 3' terminal "TGGC" come from?

                        --
                        Phillip

                        Comment


                        • #27
                          Originally posted by pmiguel View Post
                          Where does the 3' terminal "TGGC" come from?
                          Phillip
                          Sorry, I didn't make it clear - I meant that TGGC is only in internal adapter, not in this one. Adaptors from the ligation mix are marked in red/magenta.

                          Comment


                          • #28
                            Originally posted by aushev View Post
                            Sorry, I didn't make it clear - I meant that TGGC is only in internal adapter, not in this one. Adaptors from the ligation mix are marked in red/magenta.
                            Ah, I get it now.

                            Thanks for your post. I got the extensive patent documentation. I have not carefully read it, but it looks very interesting. ECO had mentioned elsewhere how useful these could be, but I'd never checked for myself.

                            I am not understanding the motivations for companies to be so secretive about information disclosed publicly in their patent applications. What is up with that?

                            --
                            Phillip

                            Comment


                            • #29
                              I'm not sure to understand ... the IA you're speaking about..is the IA given from the hybridization of MPL and MPR adaptors? because I've tried to sequence the IA by Sanger technologies and what I found is that I can read correctly the first bases and the lasts, but in the middle the sequence is a "double-seq"!!

                              THANKS chiara

                              Comment


                              • #30
                                Originally posted by koala View Post
                                I'm not sure to understand ... the IA you're speaking about..is the IA given from the hybridization of MPL and MPR adaptors? because I've tried to sequence the IA by Sanger technologies and what I found is that I can read correctly the first bases and the lasts, but in the middle the sequence is a "double-seq"!!

                                THANKS chiara
                                The IA (Internal Adapter) is a "center adapter" in SOLiD mate-pair library construction--the one that attaches the two ends of the large DNA fragment into a circle. I don't want to descend into the depths of mate-pair library construction here, but you end up with:

                                adapter P1-insert1-IA-insert2-adapter P2

                                , where the inserts are either end of the same long DNA fragment. You prime one read from inside IA, and the other from P1.

                                For their bar coding strategy for fragment libraries, ABI decided to re-purpose the mate-pair structure:

                                adapter P1-insert-IA-BC-adapter P2

                                Then you get your bar code read from the IA-primed read.

                                I think you are right, in the most recent iteration of ABI's mate pair library construction kit, the IA would be formed by the hybridization of MPL and MPR. They used to just have a double-stranded internal adapter that allowed circularization via a ligation.

                                --
                                Phillip

                                Comment

                                Latest Articles

                                Collapse

                                • seqadmin
                                  Improved Targeted Sequencing: A Comprehensive Guide to Amplicon Sequencing
                                  by seqadmin



                                  Amplicon sequencing is a targeted approach that allows researchers to investigate specific regions of the genome. This technique is routinely used in applications such as variant identification, clinical research, and infectious disease surveillance. The amplicon sequencing process begins by designing primers that flank the regions of interest. The DNA sequences are then amplified through PCR (typically multiplex PCR) to produce amplicons complementary to the targets. RNA targets...
                                  Yesterday, 01:49 PM
                                • seqadmin
                                  Targeted Sequencing: Choosing Between Hybridization Capture and Amplicon Sequencing
                                  by seqadmin




                                  Targeted sequencing is an effective way to sequence and analyze specific genomic regions of interest. This method enables researchers to focus their efforts on their desired targets, as opposed to other methods like whole genome sequencing that involve the sequencing of total DNA. Utilizing targeted sequencing is an attractive option for many researchers because it is often faster, more cost-effective, and only generates applicable data. While there are many approaches...
                                  03-10-2023, 05:31 AM
                                • seqadmin
                                  Expert Advice on Automating Your Library Preparations
                                  by seqadmin



                                  Using automation to prepare sequencing libraries isn’t a new concept, and most researchers are aware that there are numerous benefits to automating this process. However, many labs are still hesitant to switch to automation and often believe that it’s not suitable for their lab. To combat these concerns, we’ll cover some of the key advantages, review the most important considerations, and get real-world advice from automation experts to remove any lingering anxieties....
                                  02-21-2023, 02:14 PM

                                ad_right_rmr

                                Collapse

                                News

                                Collapse

                                Topics Statistics Last Post
                                Started by seqadmin, 03-17-2023, 12:32 PM
                                0 responses
                                14 views
                                0 likes
                                Last Post seqadmin  
                                Started by seqadmin, 03-15-2023, 12:42 PM
                                0 responses
                                18 views
                                0 likes
                                Last Post seqadmin  
                                Started by seqadmin, 03-09-2023, 10:17 AM
                                0 responses
                                68 views
                                1 like
                                Last Post seqadmin  
                                Started by seqadmin, 03-03-2023, 12:03 PM
                                0 responses
                                64 views
                                0 likes
                                Last Post seqadmin  
                                Working...
                                X