Header Leaderboard Ad

Collapse

Visitor message from uzi_maruzi

Collapse

Announcement

Collapse
No announcement yet.

Profile Sidebar

Collapse
Avatar
uzi_maruzi
Junior Member
Last Activity: 11-14-2022, 11:42 PM
Joined: 11-10-2022

  • Visitor message from uzi_maruzi

    uzi_maruzi
    uzi_maruzi posted a Visitor Message for uzi_maruzi
    TRIMMOMATIC custom adapters sequence

    It's the first time for me to process NGS reads. I got my reads from BGI-sequencer and used trimmomatic in Galaxy, and the adapters sequence were given like this by the sequencer company:

    i7_Index_ID i7index配列 i5_Index_ID i5index配列
    DNA Index i7ID i7Seq i5ID i5Seq
    SG-003 M5041/M7091 M7091 CAATCGTT M5041 CTGCGGAT
    SG-015 M5041/M7092 M7092 AGCCATAC M5041 CTGCGGAT

    So, I create the fasta using those sequences as follow:
    >index1/1
    GGTCCATT
    >index1/2
    TTAGGTAG
    >index2/1
    GGTCCATT
    >index2/2
    GGTCACTA
    >index3/1
    GGTCCATT
    >index3/2
    TCCGCACT
    ...etc...

    Did I use the information correctly? I heard that others have been using this sequence to remove the adapters.
    >Forward AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA
    >Reverse AAGTCGGATCGTAGCCATGTCGTTCTGTGAGCCAAGGAGTTG

    Thank you.

  • seqadmin
    commented
    Hello,
    You posted the message to your own account. Did you mean to ask this question in the forum?
  • Leave a comment:

Working...
X