303 results in 0.0043 seconds.
-
Alignment Quality Tools for BWA and Tophat
How can I assess the quality of my outputs for BWA and Tophat to make comparisons between them? I am looking at RNASeq data. -
bwa and nanopore reads
Has anyone used bwa (0.7.12) with the mem -x ont2d option on nanopore 2D reads? FAQ's in bwa doc says "BWM-MEM works with Oxford Nanopore reads... -
call indel and SNP by varscan
Hi all,
I met problem when I work on a 7M bacterium genome. I mapped 140x of paired-end reads (151x2) from illumina to a Pacbio reference... -
454 reads mapping to more than one scaffold?
Hey guys, I've been struggling with this question for a while, since I don't program very well.
So, I've mapped some 454 contigs to a very... -
bwa mis-alignment of TruSeq Amplicon reads
I'm having the following issues using bwa mem on paired-end TruSeq Amplicon reads. I used the default settings with mem. The top sequence... -
bwa mem, the -a option
Hi all,
From the bwa documentation:
"-a Output all found alignments for single-end or unpaired paired-end reads. These alignments... -
Yet Another bwa mem unique post
So, I am using the following version of BWA
Program: bwa (alignment via Burrows-Wheeler transformation)
Version: 0.7.12-r1039</pre>... -
bwa mem don't set PROPER_PAIR flag in pair end align
$ cat r1.fq
@1
GGGCTAAGAGACAGCAAATACACATGAACAGAAAGAAGAGGGCAAAGAAAAGGCTGACGG
+
CCCFFFFFHHFHHJIJIJIJJJJJJJJDIJJJJJIJJIJJIIGIJJJJHIHJJJJIHIHI... -
Why is samtools mpileup reporting all zero quality scores?
Hi everyone.
I'm calling some variants using samtools from a BWA-aligned and sorted BAM.
For some reason, the samtools mpileup... -
Why do human genome studies use bwa 0.5.9?
Many papers in human genetics including published in this year have used bwa 0.5.9 for HiSeq reads mapping instead of upper versions.
... -
bwa mem does not find all alignments found by bowtie in multi-hit mode
I generated a set of simulated reads from one microbial reference genome and would like to find all alignments of these reads against a large set of genomes.... -
FFPE Aware aligner
Hello fellow seq-uers, long time forum user, first time poster almost.
So I have been going through a thought experiment and we have collected... -
BWA-SW contig to reference -- what was unaligned?
I used BWA-SW to align 60 contigs to a reference genome. The resulting SAM file has 339 entries (I did `samtools view -c myfile.sam`). All of these are... -
strange GT values from GATK
Hi,
I am looking at some data processed through Illumina's BWA+GATK pipeline.
I found some funny GT values, like:
... -
BWA alignment using paired end reads from different lanes
Hi,
I would need some help on to proceed for WES analysis.
I observed from different posts in the forum that the paired...
