Hello !
I am doing genome sequence alignment using MUMmer, in particular I want to do a dotplot with mummerplot. So the passages that I...
9 results in 0.0030 seconds.
-
What is the file .mums created by mummer ?
-
Download all bacteria genomes in .gbk format
Hello all,
Sorry if this has been posted before, but after searching the internet I seem to be at a dead end.
I currently... -
Add 'missing' lines of data by using python code
So I am a beginner when it comes to programming and python and such. But I think I have a very simple question.
I have large tab-delimited... -
TCGA - missing file for LAML project
Hello,
Not sure this is the best place to post this question, but perhaps somebody has the answer. For the analysis I am doing, I have... -
Tophat2 deletions.bed output question
Hi all,
Just a quick question for you: in Tophat's deletions.bed file, what does the last column in the file indicate? The tophat manual... -
Easy library to read and write genomic files
Hi guys !
I just finished work on a python package that can read most of the genomic file formats such as BED, WIG, GFF, BedGraph in a... -
htseq count missing last mapped fragment
I am using the program htseq-count v0.5.3 with an standard sam file from the mapping of a set of paired end reads. Comparing this file with the output... -
Galaxy workflow management system customization - avoiding duplication of files
Hi all,
My team is trying to set up an instance of galaxy workflow management system (http://galaxy.psu.edu/) that will launch jobs on... -
bowtie index location question
Dear all,
when I type the command:
~/where/my/data/is $ bowtie -a -v 2 hg19 -c GTTCGATGAAATCTTCTTTTTCTGTTTTCACTTGGG
...
