Search Result - SEQanswers

You are currently viewing the SEQanswers forums as a guest, which limits your access. Click here to register now, and join the discussion

Search Results: 1 result in 0.0030 seconds.

rifah23 started a topic Calculating total number of exons in the human copy of a gene

in General

10-25-2014, 12:46 PM
Calculating total number of exons in the human copy of a gene

For example if given this sequence:

CAACTCAGCCATTGTTAAAAGCCCACCCTAAGTTTTCAAAGAAATTTCACGACAAC
GAGAAAGCAAGAGGCAAAGCGATCCATCAAGCCAACCTTCGACATCTCTGCCGCA...

See more | Go to post

Last edited by rifah23; 10-25-2014, 12:48 PM.

Previous template Next

Working...