Hi,
I need to remove all 'N' strings in a fastq file. I have paired end files and there are N strings at the end of some reads of variable...
2 results in 0.0030 seconds.
-
Trim off variable length 'N' strings at the end of the read
-
Bowtie2 is unable to align query sequences that contain an intervening stretch of N's
If I have a reference sequence:
>reference
CTAGAATATCACTTAGGCCGGTATTCTATTACTGTACTTCGCGTAAGCTGCTTTAACCC
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN...