Search Result - SEQanswers

You are currently viewing the SEQanswers forums as a guest, which limits your access. Click here to register now, and join the discussion

Search Results: 2 results in 0.0021 seconds.

stighe started a topic Illumina Sequencing Primer questions

in Illumina (Solexa)

06-28-2013, 12:30 PM
Illumina Sequencing Primer questions

Dear HiSeqers

Can anyone confirm the sequence of the SE v3 sequencing primer. Best I can find is 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3',...

See more | Go to post
Akira started a topic Validation of Custom Sequencing Primer

in Illumina (Solexa)

07-19-2012, 11:28 PM
Validation of Custom Sequencing Primer

Hi.

I would like to use my own sequencing primer. I design it with properties (Tm
and GC content and length etc) close to standard...

See more | Go to post

Previous template Next

Working...