Hello
I was trying to find structural variations from 454 reads using tophat.
However, all the results from tophat were empty.
There seemed to be no problem with running tophat.
I found that most of the 454 reads contained a long 5'-most extra sequence (39bp).
5' tcag+ACGAGTGCGT+AAGCAGTGGTATCAACGCAGAGTT+ mRNA........3'
---- ------------- -------------------------------
key MID cDNA library primer
I wonder whether tophat trim the extra sequence off during alignment. Or should I remove them manually before I run tophat?
I was trying to find structural variations from 454 reads using tophat.
However, all the results from tophat were empty.
There seemed to be no problem with running tophat.
I found that most of the 454 reads contained a long 5'-most extra sequence (39bp).
5' tcag+ACGAGTGCGT+AAGCAGTGGTATCAACGCAGAGTT+ mRNA........3'
---- ------------- -------------------------------
key MID cDNA library primer
I wonder whether tophat trim the extra sequence off during alignment. Or should I remove them manually before I run tophat?