Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • #31
    Originally posted by wjeck View Post
    I think, tough this is not with any authority, that

    ID = id name for the readgroup
    SM = sample name
    LB = label? dunno about this one
    PL = platform

    These are not currently standardized (I think) but ARE used by the Broad GATK, which means getting them right may be important for your pipeline
    LB is library.

    For many tools the really important field is ID, which must be unique to the read group. Reads are considered to be from different experimental conditions if they have different read groups. So we usually form our readgroup IDs by concatenating all the relevant information that uniquely identifies the experimental conditions (run/flowcell, lane, etc).

    Comment


    • #32
      I run a bash script with samtools merge -h rg.txt -r

      below is the list of my rg.txt

      @RG ID:Kapo93+94+95_1_09-1107_091207_HWI-EAS418_9_s_7 DS:091207_HWI-EAS418_9 SM:09-1107
      @RG ID:Kapo93+94+95_1_09-1107_100618_ILLUMINA-8C38E9_0112_s_3 DS:100618_ILLUMINA-8C38E9_0112 SM:09-1107
      @RG ID:Kapo93+94+95_1_09-1107_110103_HWUSI-EAS1785_0223_s_2 DS:110103_HWUSI-EAS1785_0223 SM:09-1107
      @RG ID:Kapo93+94+95_1_09-1107_110616_SN588_0054_AC00T5ABXX_s_4 DS:110616_SN588_0054_AC00T5ABXX SM:09-1107
      @RG ID:Kapo93+94+95_1_09-1107_111028_SN653_0108_BB0418ABXX_s_3 DS:111028_SN653_0108_BB0418ABXX SM:09-1107
      @RG ID:Kapo93+94+95_1_09-1107_120216_SN670_0098_AC04HRABXX_s_1 DS:120216_SN670_0098_AC04HRABXX SM:09-1107
      @RG ID:Kapo93-95-1_09-1107_110714_SN588_0055_AB0A5UABXX_s_1 DS:110714_SN588_0055_AB0A5UABXX SM:09-1107

      I get this error and can't merge the bams:

      ##### ERROR MESSAGE: SAM/BAM file SAMFileReader{/xxxxx/xxxx/xxx/xxxxx/Kaposi/Kapo93+94+95/09-1107/Kapo_93-95_09-1107_merged_s_99.nodup.bam} is malformed: Read ILLUMINA-8C38E9_0112:3:84:1445:15512#0 is either missing the read group or its read group is not defined in the BAM header, both of which are required by the GATK. Please use http://gatkforums.broadinstitute.org...lacereadgroups to fix this problem
      ##### ERROR

      I have tried pretty much everything that I can at this point and it would be really nice to get this work. Any help is appreciated.

      Comment


      • #33
        Hello, Wjeck and others on this blog:

        Picard AddOrReplaceReadGroups does not seem to work for me. Below is the command I used and the first part of bam file it generated. No @RG was added.

        Am I missing anything? Your help is greatly appreciated.


        java -Xmx4g -XX:ParallelGCThreads=12 -jar /work/nrap1100/bin/picard-tools-1.78/AddOrReplaceReadGroups.jar I=Sample_RS-01812720/merged.bam O=A1_M1.bam RGID=null RGLB=$d RGPL=Illumina RGSM=A1_M1 RGPU=TAAGGCG

        samtools view A1_M1.bam |head
        8LSZMS1:104:C4KJNACXX:1:1203:8209:39039 145 chr10 3100000 37 101M chr12 59597178 0 AGAATTCTCACCTGAGAAATACCGAATGGCAGAGAAACACCTGAATAAAATGTTCAACATCCTTAATCATCAGGGAAATGCAAATCAAAACAACACTGAGA EDDEECEEEDFEFFFHHHHHHIJJJJJJJJJJIJIIJIHJJIJJIGIJJIIJIIGIJJIJJJJJJJIJJIJJJJJJJJJJJJJJIJJJHHHHHFEFDF@BB X0:i:1 X1:i:0 MD:Z:101 XG:i:0 AM:i:0 NM:i:0 SM:i:37 XM:i:0 XN:i:1 XO:i:0 XT:A:U
        8LSZMS1:104:C4KJNACXX:1:2105:3168:69401 99 chr10 3100097 57 101M = 3100236 240 GAGATTCCACTTCACTCCAGTTAGAATGGCTAAGATCAAAAACTCAGGTGACAACAGATGTTGGCGAGGATGTGGAGAAAGGGGAACACTCCTCCATTGTT CC@FFFFFHHHHHJJJJJJJIIJGIIJJJJJJJJIIIIJJJJJGGIGHBGHIJJJJJJJIIGHIJJJJHFFFDEFEDECCCBDDDDDDDACDDDDDDDDED X0:i:1 X1:i:2 XA:Z:chr4,+72093156,101M,1;chr7,+144726933,101M,1; MD:Z:101 XG:i:0 AM:i:20 NM:i:0 SM:i:20 XM:i:0 XO:i:0 XT:A:U
        8LSZMS1:104:C4KJNACXX:1:1212:1749:88430 99 chr10 3100168 29 101M = 3100238 171 GTGGAGAAAGGGGAACACTCCTCCATTGTTGGTGGGATTGCAAGCTTGTACAACCACTCTGGAAATCAGTCTGGCGGTTCCTCAGAAAATTGGACATAGTA CCCFFFFFHGGHHJJIJJJJIJJJJJJJIJJJGGIIGIIJIIGIJJJJGHIJJJJJJJJJJHHHHHFFFFFFEEEBD@BDDDDDDDDDDDDDDDDDDDDEE X0:i:452 MD:Z:101 XG:i:0 AM:i:0 NM:i:0 SM:i:0 XM:i:0 XO:i:0 XT:A:R

        Comment


        • #34
          Why in the world would you use 12 threads to add or replace read groups?

          -XX:ParallelGCThreads=12

          More importantly, you need to specify the parameter -H (or -h) to view the header.

          samtools view -H A1_M1.bam
          or
          samtools view -h A1_M1.bam | more
          Last edited by blancha; 06-26-2014, 04:30 PM.

          Comment


          • #35
            Thanks for your quick reply, Blancha! The use 12 threads was unintended and was really unnecessary, and I know the use -H/h in samtools view, which just displays the header. But I was talking about the actual RG tags added to each alignment line, which was missing from mine bam file generated by picard AddOrReplaceReadGroups. I am looking into the perl script posted by Brugge.

            Comment


            • #36
              I'm not an expert on the SAM format, and it's not a particularly interesting subject, to be honest.
              Some of the RG tags only appear in the header, I believe.
              In my BAM files, only the RGID appears on each alignment line, but you set it to null.
              RGLB, RGPL, RGSM and RGPU only appear in the header.

              If you have trouble falling asleep, you can read the SAM format specification.

              Only ID is specified as being used in the RG tags of alignment records.

              If I'm wrong, feel free to correct me.
              Last edited by blancha; 06-26-2014, 06:28 PM.

              Comment


              • #37
                Hello all,

                Thank you all for your posts,
                first I would like to tell you all, I am trying to add RG tags and sample ID to a list of sorted bam files, i have tried all the above mentioned scripts. i was able to add the RG tags to all my files, later calling with freebayes for SNP, my ouput vcf file has only the header part
                #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT L6-6

                the rest is empty. could some one help me with this, all i need is after i call for SNP, i would like to have all the genotypes labeled with the specific sample IDs.

                Thank you all

                Comment


                • #38
                  Did you merge into one bam file (and if so, with which tool) or supply freebayes with several BAM files?

                  Could you post the output from

                  Code:
                  samtools view -H file.bam | grep "^@RG"
                  for either your merged file (if you have one) or a few of your single sample files and the exact freebayes call you used?

                  Comment


                  • #39
                    Thank you for your reply,

                    I merged into one bam file before i suppled to freebayes, the above grep for my bam file looks empty, but when it view it has rg tags RG:Z:f11-12

                    thanks

                    Comment


                    • #40
                      What tool did you use to merge the BAM files and what do you get if you perform the grep command that sarvidsson posted on one of the unmerged BAM files? The problem you're running into is due to not having read group information in the BAM header. Most tools will read this to create a dictionary of valid read groups that alignments can have.

                      Comment


                      • #41
                        Originally posted by kapr0007 View Post
                        Thank you for your reply,

                        I merged into one bam file before i suppled to freebayes, the above grep for my bam file looks empty, but when it view it has rg tags RG:Z:f11-12

                        thanks
                        Then something went wrong in merging those BAMs (what did you use for this step?); your header got truncated. If the individual BAM files have intact headers - with the read groups in there, you can simply feed Freebayes with several BAM files.

                        Comment


                        • #42
                          Hi, this is the command i used

                          perl -e ’print "@RG\tID:FP\tSM:F11-12\tLB:FP\tPL:Illumina\n@RG\tID:FP\tSM:L6-6\tLB:FP\tPL:Illumina\n"’ > rg1.txt
                          samtools merge -rh rg1.txt merged_f11-l6 l6-6.bam f11-12.bam

                          Comment


                          • #43
                            Originally posted by kapr0007 View Post
                            Hi, this is the command i used

                            perl -e ’print "@RG\tID:FP\tSM:F11-12\tLB:FP\tPL:Illumina\n@RG\tID:FP\tSM:L6-6\tLB:FP\tPL:Illumina\n"’ > rg1.txt
                            samtools merge -rh rg1.txt merged_f11-l6 l6-6.bam f11-12.bam
                            Check your rg1.txt, you need to escape the '@'s:

                            Code:
                            perl -e ’print "\@RG\tID:FP\tSM:F11-12\tLB:FP\tPL:Illumina\n\@RG\tID:FP\tSM:L6-6\tLB:FP\tPL:Illumina\n"’ > rg1.txt
                            gives a correct header file. I guess you can leave out "-r" in the samtools call, didn't test that however (given that the single files have correctly set read groups already, if not you can skip the -h and the rg1.txt file and only use the -r feature).
                            Last edited by sarvidsson; 02-23-2015, 05:54 AM.

                            Comment


                            • #44
                              thanks for you quick reply,

                              my rg.txt is ID:FP SM:F11-12 LB:FP PL:Illumina
                              ID:FP SM:L6-6 LB:FP PL:Illumina

                              with your code "\@RG... looks like. should it be like this?

                              @RG ID:FP SM:F11-12 LB:FP PL:Illumina
                              @RG ID:FP SM:L6-6 LB:FP PL:Illumina

                              with try leaving -r in samtools,

                              appreciate your quick reply

                              Comment


                              • #45
                                Originally posted by kapr0007 View Post
                                thanks for you quick reply,

                                my rg.txt is ID:FP SM:F11-12 LB:FP PL:Illumina
                                ID:FP SM:L6-6 LB:FP PL:Illumina

                                with your code "\@RG... looks like. should it be like this?

                                @RG ID:FP SM:F11-12 LB:FP PL:Illumina
                                @RG ID:FP SM:L6-6 LB:FP PL:Illumina

                                with try leaving -r in samtools,

                                appreciate your quick reply
                                Yes, that looks OK. Varsågod!

                                Comment

                                Latest Articles

                                Collapse

                                • seqadmin
                                  Best Practices for Single-Cell Sequencing Analysis
                                  by seqadmin



                                  While isolating and preparing single cells for sequencing was historically the bottleneck, recent technological advancements have shifted the challenge to data analysis. This highlights the rapidly evolving nature of single-cell sequencing. The inherent complexity of single-cell analysis has intensified with the surge in data volume and the incorporation of diverse and more complex datasets. This article explores the challenges in analysis, examines common pitfalls, offers...
                                  06-06-2024, 07:15 AM
                                • seqadmin
                                  Latest Developments in Precision Medicine
                                  by seqadmin



                                  Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

                                  Somatic Genomics
                                  “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
                                  05-24-2024, 01:16 PM

                                ad_right_rmr

                                Collapse

                                News

                                Collapse

                                Topics Statistics Last Post
                                Started by seqadmin, Yesterday, 07:23 AM
                                0 responses
                                8 views
                                0 likes
                                Last Post seqadmin  
                                Started by seqadmin, 06-17-2024, 06:54 AM
                                0 responses
                                12 views
                                0 likes
                                Last Post seqadmin  
                                Started by seqadmin, 06-14-2024, 07:24 AM
                                0 responses
                                24 views
                                0 likes
                                Last Post seqadmin  
                                Started by seqadmin, 06-13-2024, 08:58 AM
                                0 responses
                                18 views
                                0 likes
                                Last Post seqadmin  
                                Working...
                                X