Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Tophat oddness

    I've been using tophat with some success until recently. I have one data set that seems to me to be the exact same as my other files, in the same format etc (I even changed the name lines to match the older files that I know work). When I run these files I do not get any errors I just get very very little aligning. Bowtie will align less then 1% of the reads so there is basically no islands for tophat and hence no junctions. With the really big files I might get a few thousand junctions but i don't think I should trust it given the situation. I would be happy to give anyone with any ideas more details, I am just not sure what would be useful.

    tophat -o/.../outfolder /home/.../genome /home/.../readfile

    @SRR012345.1 FC36:2:1:597:470 length=32
    GGGATACATTGCCAAGCTCCGCTGCCAGATTA
    +SRR012345.1 FC36:2:1:597:470 length=32
    IIIIIIIIIIIII?3II3I$C>I><I&&4&C%

    32bp reads not paired end
    I am on ubuntu 9.10

  • #2
    Am I missing something obvious or is everyone else as baffled as me?

    Comment

    Latest Articles

    Collapse

    • seqadmin
      Best Practices for Single-Cell Sequencing Analysis
      by seqadmin



      While isolating and preparing single cells for sequencing was historically the bottleneck, recent technological advancements have shifted the challenge to data analysis. This highlights the rapidly evolving nature of single-cell sequencing. The inherent complexity of single-cell analysis has intensified with the surge in data volume and the incorporation of diverse and more complex datasets. This article explores the challenges in analysis, examines common pitfalls, offers...
      06-06-2024, 07:15 AM
    • seqadmin
      Latest Developments in Precision Medicine
      by seqadmin



      Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

      Somatic Genomics
      “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
      05-24-2024, 01:16 PM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by seqadmin, 06-21-2024, 07:49 AM
    0 responses
    14 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 06-20-2024, 07:23 AM
    0 responses
    14 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 06-17-2024, 06:54 AM
    0 responses
    16 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 06-14-2024, 07:24 AM
    0 responses
    25 views
    0 likes
    Last Post seqadmin  
    Working...
    X