Seqanswers Leaderboard Ad



No announcement yet.
  • Filter
  • Time
  • Show
Clear All
new posts

  • TopHat SAM file error


    A recent paired-end TopHat run on my data created SAM files with a error I have not seen before: for the two pairs, even if the best match is found on different chromosomes, field 7 in the Alignment section (MRNM) has the value "=", which should be true only if they were on the same chromosome. I am pasting an example below, where the two PE mates map to chr1 and chrX.

    42RFMAAXX:2:089:0997:0562       177     chr1    225935280       255     51M     =       114953101       0       ATAACACTCCAATACCACTTTGTTGTCAGTGTAAACAAGGGCATATCCCGG  >=?>B9@?@ABBA>B?=BAA9AB>AB9BB@B?CC@=CBBBCB?@:BA>@>B      NM:i:2
    42RFMAAXX:2:089:0997:0562       113     chrX    114953101       255     51M     =       225935280       0       TTGACATTGTCTCTCTTTTTGACTTTCCTTTTGCCTCTGTCTCTTCCTCAC  B@>?C?B?BBCBBBCB?B:AB?BBA<@BBAABABBB@CA@B@CBBC@BB?B      NM:i:1
    Has anyone encountered this before?


    Last edited by shurjo; 06-01-2010, 09:46 AM.

Latest Articles


  • seqadmin
    Current Approaches to Protein Sequencing
    by seqadmin

    Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
    04-04-2024, 04:25 PM
  • seqadmin
    Strategies for Sequencing Challenging Samples
    by seqadmin

    Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...
    03-22-2024, 06:39 AM





Topics Statistics Last Post
Started by seqadmin, 04-11-2024, 12:08 PM
0 responses
Last Post seqadmin  
Started by seqadmin, 04-10-2024, 10:19 PM
0 responses
Last Post seqadmin  
Started by seqadmin, 04-10-2024, 09:21 AM
0 responses
Last Post seqadmin  
Started by seqadmin, 04-04-2024, 09:00 AM
0 responses
Last Post seqadmin  