Seqanswers Leaderboard Ad



No announcement yet.
  • Filter
  • Time
  • Show
Clear All
new posts

  • BWA Uniquely Mapped Reads

    Hello, everyone!
    This is an alignment output I got from "bwa sampe", and as I know, "XT:A:U" means "reads uniquely mapped to reference", but I also got the alternative hits of "XA:...", why is that?? And if I only care about uniquely mapped reads, is this kind of reads what I want? Please help me out, Thanks A Lot!

    d5_lpEsQulsn42 147 chr4 110995170 60 63M = 110995022 -211 TTTCTTTTGCCTGATTGCCCTGGCCAGAGCTTCCAATACTGTGTTGAATAGGAGTGGTGAGAG __aYbaaa_c_bbabWaa`_\bbbbabb`bbbbbbbbbabbbbbbbbbbbbbbbbbbbbbbbb XT:A:U NM:i:0 SM:i:23 AM:i:23 X0:i:1 X1:i:1 XM:i:0 XO:i:0 XG:i:0 MD:Z:63 XA:Z:chr11,-121159338,63M,1;
    Last edited by NF_seq; 09-06-2010, 03:38 AM.

Latest Articles


  • seqadmin
    The Impact of AI in Genomic Medicine
    by seqadmin

    Artificial intelligence (AI) has evolved from a futuristic vision to a mainstream technology, highlighted by the introduction of tools like OpenAI's ChatGPT and Google's Gemini. In recent years, AI has become increasingly integrated into the field of genomics. This integration has enabled new scientific discoveries while simultaneously raising important ethical questions1. Interviews with two researchers at the center of this intersection provide insightful perspectives into...
    02-26-2024, 02:07 PM
  • seqadmin
    Multiomics Techniques Advancing Disease Research
    by seqadmin

    New and advanced multiomics tools and technologies have opened new avenues of research and markedly enhanced various disciplines such as disease research and precision medicine1. The practice of merging diverse data from various ‘omes increasingly provides a more holistic understanding of biological systems. As Maddison Masaeli, Co-Founder and CEO at Deepcell, aptly noted, “You can't explain biology in its complex form with one modality.”

    A major leap in the field has
    02-08-2024, 06:33 AM





Topics Statistics Last Post
Started by seqadmin, 02-28-2024, 06:12 AM
0 responses
Last Post seqadmin  
Started by seqadmin, 02-23-2024, 04:11 PM
0 responses
Last Post seqadmin  
Started by seqadmin, 02-21-2024, 08:52 AM
0 responses
Last Post seqadmin  
Started by seqadmin, 02-20-2024, 08:57 AM
0 responses
Last Post seqadmin  