Reads are 0 in htseq-count

[MariaF]

Hello,

I have a trouble using htseq-count, I used TopHat to aling my data, but when I tried to count the number of reads all the genes present 0 read.

I checked the chromosome names in ./gtf file: cut -f 1 -d " " ~/HG19/genes.gtf | cut -f 1 | sort | uniq So all of them are started with "chr". The same result was accepted by bowtie2-inspect --names ~/HG19/genome. (in .gtf file, I've seen the numbers like "chrHSCHR9_2_CTG3" and don't know what it is).

1) programs/tophat2 -p 4 -r 50 -G ~/HG19/genes.gtf -o tst_output HG19/genome tst_fastq Result: accepted_hits.bam deletions.bed junctions.bed prep_reads.info align_summary.txt insertions.bed logs unmapped.bam

samtools view -H ./accepted_hits.bam:

@HD VN:1.0 SO:coordinate @SQ SN:chr1 LN:249250621 @SQ SN:chr10 LN:135534747 @SQ SN:chr11 LN:135006516 @SQ SN:chr12 LN:133851895 @SQ SN:chr13 LN:115169878 @SQ SN:chr14 LN:107349540 @SQ SN:chr15 LN:102531392 @SQ SN:chr16 LN:90354753 @SQ SN:chr17 LN:81195210 @SQ SN:chr18 LN:78077248 @SQ SN:chr19 LN:59128983 @SQ SN:chr2 LN:243199373 @SQ SN:chr20 LN:63025520 @SQ SN:chr21 LN:48129895 @SQ SN:chr22 LN:51304566 @SQ SN:chr3 LN:198022430 @SQ SN:chr4 LN:191154276 @SQ SN:chr5 LN:180915260 @SQ SN:chr6 LN:171115067 @SQ SN:chr7 LN:159138663 @SQ SN:chr8 LN:146364022 @SQ SN:chr9 LN:141213431 @SQ SN:chrM LN:16571 @SQ SN:chrX LN:155270560 @SQ SN:chrY LN:59373566 @PG ID:TopHat VN:2.1.1 CLrograms/tophat -p 4 -r 50 -G ~/HG19/genes.gtf -o tst_output HG19/genome tst.fastq

less align_summary.txt:

Reads: Input : 99 Mapped : 76 (76.8% of input) of these: 1 ( 1.3%) have multiple alignments (0 have >20) 76.8% overall read mapping rate.

2) samtools view -h tst_output/accepted_hits.bam | htseq-count - ~/HG19/genes.gtf > tst_count.txt tail tst_count.txt:

ENST00000610276 0 ENST00000610277 0 ENST00000610278 0 ENST00000610279 0 ENST00000610280 0 __no_feature 40 __ambiguous 27 __too_low_aQual 0 __not_aligned 0 __alignment_not_unique 15

I have no idea what should I do, so could you please help me.

PS: after samtools sort -n -o temp-sorted.bam accepted_hits.bam I have the same result ("SO:queryname" in temp-sorted.bam file).

Thanks,
Maria.

[GenoMax]

It looks like you are mixing and matching genome builds and annotation. "chr" designations on your chromosomes indicates that the data is from UCSC but your annotation has ENST* identifiers which indicates Ensembl as the origin.

I suggest that you find annotation that uses the chr designations for doing the counting.

BTW: Please stop using TopHat. It is not even recommended by its authors. There are current options like STAR/bbmap/HISAT2 that should be used instead.

[MariaF]

It looks like you are mixing and matching genome builds and annotation. "chr" designations on your chromosomes indicates that the data is from UCSC but your annotation has ENST* identifiers which indicates Ensembl as the origin.

I suggest that you find annotation that uses the chr designations for doing the counting.

BTW: Please stop using TopHat. It is not even recommended by its authors. There are current options like STAR/bbmap/HISAT2 that should be used instead.

Thanks, GenoMax, you are absolutely right: my annotation was Ensembl and my .fa was UCSC.

I downloaded the annotation from http://genome.ucsc.edu/cgi-bin/hgTables - is it correct?

head my .gtf file:

chr1 hg19_knownGene exon 11874 12227 0.000000 + . gene_id "uc001aaa.3"; transcript_id "uc001aaa.3";
chr1 hg19_knownGene exon 12613 12721 0.000000 + . gene_id "uc001aaa.3"; transcript_id "uc001aaa.3";
chr1 hg19_knownGene exon 13221 14409 0.000000 + . gene_id "uc001aaa.3"; transcript_id "uc001aaa.3";

All reads are zero in htseq-count again.

my .fastq file:

@ERR599187.1 HWI-ST1034:1070DURACXX:4:1101:1451:1992/1
ATCGCCTCCTGNTAGGCCAGCTCTACATCTTCTTGGGTGACCACTAGTTTAATCTTATTCCATTTCTCAGGGATATCCAGCCACTGGTGCACAGCCACTGC
+
@@@DDDDDHHH#2AEHG>EG?GAGA>FECHIIIICEG?GFBBCGHDFIFGIIIIGGHAFHIIIGG=DDAHBHH@DEDEECBCC@BCCCCCCCBBBCCCC
@ERR599187.2 HWI-ST1034:1070DURACXX:4:1101:1687:1994/1
AAAAGAAGTAANATAAGAAGGCAATGCTTGTGGAATGTACAGTGCATATTGGCGGCGCACGCCTCATTACGATTCGCCTGCTTTCTTCTCCTGTTCAATCG
+
@@@DDDDDHHH#3AFHGGGGII@EHIGIIIIIGIBGHHIFGI0BFBGIII@H<FE8=/398=89@@CD#################################
@ERR599187.3 HWI-ST1034:1070DURACXX:4:1101:1636:1996/1
CACCCACGGAANCGAGAAAGAGCTATCAATCTGTCAATCCTGTCCGTGTCCGGGCCGGGTGAGGGTTCCCGTGTTGGGTCAAATTAAGCCGCAGGCTCCAC
+
@@@?DD=DD<F#222CFHIGIC;FHEDDGH@H4?<9BGHE<FFHGGIGIIGHA4=>C@#########################################

tail test_count.txt

uc031tkv.1 0
uc031tkw.1 0
uc031tkx.1 0
uc031tky.1 0
uc031tkz.1 0
__no_feature 4
__ambiguous 0
__too_low_aQual 0
__not_aligned 0
__alignment_not_unique 0

BTW: I see what you mean, I know about STAR and HISAT-2. It's just my task.

[GenoMax]

Can you post a few lines from your SAM/BAM file? Just part of the SAM header should be fine.

[MariaF]

Thanks for your attention to my problem, GenoMax.

samtools view -H temp.samheader.sam

@HD VN:1.0 SO:unsorted
@SQ SN:0_2.65543%_cov_993_len_552 LN:552
@SQ SN:1_2.28932%_cov_1093_len_446 LN:446

samtools view -H test_genome.bwt.samheader.sam

@HD VN:1.0 SO:coordinate
@SQ SN:0_2.65543%_cov_993_len_552 LN:552
@SQ SN:10_0.802277%_cov_294_len_562 LN:562

samtools view -H accepted_hits.bam

@HD VN:1.0 SO:coordinate
@SQ SN:chr1 LN:249250621
@SQ SN:chr10 LN:135534747

I guess I downloaded the wrong annotation because I see this in the sample-file sample_count.txt:

A1BG 226
A1BG-AS1 202
A1CF 5

However, my .gtf file doesn't contain such names of genes. I can't find the annotation hg19 from UCSC which include such names.

[GenoMax]

Best solution is to get the sequence/annotation bundle from Illumina's iGenomes site (note: link is for big file download). In that download you will find a genes.gtf file in Annotation/Genes folder. Use that for your counting.

I also recommend that you use featureCounts. Much faster and easier to use.