Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Unable to intersect BAM file with bedtools

    Hi everyone, I'm trying to use bedtools intersect to check the number of mapped reads in target regions (in a .bed file) originated by targeted bisulfite sequencing experiment (EpiSeq Roche).

    I used the following command.

    Code:
    ./bedtools intersect -bed -abam sample2.bam -b 
     ~/Data/MethylSeq/dataset/Agesmoke_dataset/AgeSmkSop_all_primary_targets.bed
    The program terminate with the following message and no result at all.

    Code:
    * WARNING: File sample2.bam has inconsistent naming convention for record:
    NC_000016.9  24163386  24163537  M03971:33:000000000-BN5NL:1:2114:12003:16132/1  255  +
    
    * WARNING: File sample2.bam has inconsistent naming convention for record:
    NC_000016.9  24163386  24163537  M03971:33:000000000-BN5NL:1:2114:12003:16132/1  255  +
    I tried to modify the original SAM file removing the read that cause the problem (that was the first read in the SAM file) and the problem persists with the second read. I tried also the option -nonamecheck with no results.

    Can someone help us? Thank you.
    Nicola

  • #2
    Check your chromosome names.
    Are they "chr" style in both bed and bam?

    Comment


    • #3
      Originally posted by Richard Finney View Post
      Check your chromosome names.
      Are they "chr" style in both bed and bam?
      Hi Richard, thanks for the reply.
      About your question, I think not.

      In the bed file I have record like this:
      Code:
      chr1    11123000        11123242        chr1:11123018-11123218
      chr1    16696418        16696674        chr1:16696447-16696647
      while in the SAM file (and consequently in the BAM file) I have record like that:

      Code:
      M03971:33:000000000-BN5NL:1:2114:12003:16132    99      NC_000016.9     24163387        255     151M    =       24163431        194     TGATCGGTGGTGA
      TGGGTTAGGTAGAGTGTATTAGTTCGTTTTTATGTTGTTGATAAAGATATATTCGAGATTGTGTAATTTATGAAAAAGAGGTTTAATGGATTTGGGGAGGTTTTAATTATGGTGGAAGGTTAAAGTTATGTTTTATAT BCCCCCCBBC
      ABGGGGGGFGGGGHHHHFGGHHHHHHHHGGHGGGHHHHHHHHHHHHHHHHHHHHHHHHHHHGHHHHHHHHHHHHHFHHHHGGHHHHHHHHHHHHHHHHGGFGGEHHGHHHHHHHHHHGHHHGHHHHHHHHHHHHHHHHHHH NM:i:1
        ZS:Z:++
      Ps. the SAM file is the result of an alignment with BSMAP.

      Is this the problem? How can I resolve it?
      Nicola

      Comment


      • #4
        NC_000016 is a name used for "chr16".
        This the "official" name used at NCBI : https://www.ncbi.nlm.nih.gov/nuccore/NC_000016.10/

        You have to convert the "NCBI name" to "chr" names (or vice versa).

        There are many ways to rename fields. You can always brute force it using a custom simple program or script using your favorite programming language : bash, python, perl, C, etc.

        Any easy way would be to reheader the bam file. Please see samtools documentation for this.

        Comment


        • #5
          Originally posted by Richard Finney View Post
          NC_000016 is a name used for "chr16".
          This the "official" name used at NCBI : https://www.ncbi.nlm.nih.gov/nuccore/NC_000016.10/

          You have to convert the "NCBI name" to "chr" names (or vice versa).

          There are many ways to rename fields. You can always brute force it using a custom simple program or script using your favorite programming language : bash, python, perl, C, etc.

          Any easy way would be to reheader the bam file. Please see samtools documentation for this.
          It works, thank you so much!!
          I'm sorry for the triviality of the problem, but I'm not very practical with this stuff and the bedtools message wasn't very helpful.
          Again, thank you!

          Best regards
          Nicola

          Comment

          Latest Articles

          Collapse

          • seqadmin
            Latest Developments in Precision Medicine
            by seqadmin



            Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

            Somatic Genomics
            “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
            05-24-2024, 01:16 PM
          • seqadmin
            Recent Advances in Sequencing Analysis Tools
            by seqadmin


            The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
            05-06-2024, 07:48 AM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by seqadmin, Today, 01:32 PM
          0 responses
          3 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 05-24-2024, 07:15 AM
          0 responses
          198 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 05-23-2024, 10:28 AM
          0 responses
          220 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 05-23-2024, 07:35 AM
          0 responses
          229 views
          0 likes
          Last Post seqadmin  
          Working...
          X