Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Tophat bug -- excessively long match

    I'm running Tophat v1.2.0 with Bowtie 0.12.7.0 and Samtools 0.1.12a, on a particular RNAseq sample. Everything runs correctly until Tophat tries to use Samtools, because it creates this nonsensical alignment that chokes samtools:

    HWUSI-EAS552R_0001:1:4:10279:10944#0 163 chr17 7357209 255 78M97N536870908M92N22M = 7357535 0 CAACTATAGTCCCACATCACCCAGCTATTCGCCAACTTCACCCAGCTACTCACCCACTTCTCCCAGCTACTCACCTACCTCTCCAAGCTACTCACC CCCCCCCCCCCCCCCCCCCCCCCCCCCCCC;CC?CC?CBACCCCCCCC2C7*;;'8?2??=@?=CC@@=BA<AA@+:>50::>A+:>@:A###### NM:i:5 XS:A:- NH:i:1

    If you look at the CIGAR string you can see the problem. There's a match region that's 536870908 bp in length, in the middle of this 96 bp read. Obviously a bug.

    Has anyone else encountered this? Know if it's specific to this version of tophat? Since tophat only chokes at the final conversion of accepted_hits.sam to accepted_hits.bam, I'm planning on filtering the accepted_hits.sam to remove this, then use samtools to do the .bam conversion outside of tophat.

    Is there a better place to report tophat bugs?

  • #2
    Similar problem noted in Tophat v1.1.4 as well

    Discussion of next-gen sequencing related bioinformatics: resources, algorithms, open source efforts, etc

    Comment


    • #3
      Yep, in order to handle this, I just wrote a quick script to remove the read with the buggy CIGAR string and then ran samtools from there to create the bam files. You should be able to find the .sam files in the tophat tmp folder and can go from there.

      Comment


      • #4
        Originally posted by ebartom View Post
        I'm running Tophat v1.2.0 with Bowtie 0.12.7.0 and Samtools 0.1.12a, on a particular RNAseq sample. Everything runs correctly until Tophat tries to use Samtools, because it creates this nonsensical alignment that chokes samtools:

        HWUSI-EAS552R_0001:1:4:10279:10944#0 163 chr17 7357209 255 78M97N536870908M92N22M = 7357535 0 CAACTATAGTCCCACATCACCCAGCTATTCGCCAACTTCACCCAGCTACTCACCCACTTCTCCCAGCTACTCACCTACCTCTCCAAGCTACTCACC CCCCCCCCCCCCCCCCCCCCCCCCCCCCCC;CC?CC?CBACCCCCCCC2C7*;;'8?2??=@?=CC@@=BA<AA@+:>50::>A+:>@:A###### NM:i:5 XS:A:- NH:i:1

        If you look at the CIGAR string you can see the problem. There's a match region that's 536870908 bp in length, in the middle of this 96 bp read. Obviously a bug.

        Has anyone else encountered this? Know if it's specific to this version of tophat? Since tophat only chokes at the final conversion of accepted_hits.sam to accepted_hits.bam, I'm planning on filtering the accepted_hits.sam to remove this, then use samtools to do the .bam conversion outside of tophat.

        Is there a better place to report tophat bugs?
        I thought I fixed the bug, but it still exists. I'll be grateful if you provide me with your data set so I can fix it? (Daehwan Kim - [email protected])

        BTW, you can report a bug to [email protected]

        Comment

        Latest Articles

        Collapse

        • seqadmin
          The Impact of AI in Genomic Medicine
          by seqadmin



          Artificial intelligence (AI) has evolved from a futuristic vision to a mainstream technology, highlighted by the introduction of tools like OpenAI's ChatGPT and Google's Gemini. In recent years, AI has become increasingly integrated into the field of genomics. This integration has enabled new scientific discoveries while simultaneously raising important ethical questions1. Interviews with two researchers at the center of this intersection provide insightful perspectives into...
          02-26-2024, 02:07 PM
        • seqadmin
          Multiomics Techniques Advancing Disease Research
          by seqadmin


          New and advanced multiomics tools and technologies have opened new avenues of research and markedly enhanced various disciplines such as disease research and precision medicine1. The practice of merging diverse data from various ‘omes increasingly provides a more holistic understanding of biological systems. As Maddison Masaeli, Co-Founder and CEO at Deepcell, aptly noted, “You can't explain biology in its complex form with one modality.”

          A major leap in the field has
          ...
          02-08-2024, 06:33 AM

        ad_right_rmr

        Collapse

        News

        Collapse

        Topics Statistics Last Post
        Started by seqadmin, 02-28-2024, 06:12 AM
        0 responses
        26 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 02-23-2024, 04:11 PM
        0 responses
        74 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 02-21-2024, 08:52 AM
        0 responses
        81 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 02-20-2024, 08:57 AM
        0 responses
        69 views
        0 likes
        Last Post seqadmin  
        Working...
        X