In my tophat output, i find there is a reads mapped to the same postion twice, but with different XS:A tag as follows. And I find that only the + strand of the genome has GT-AG splice site. The two mapping positions result in two transcripts prediction on both + and - strand by cuffllinks. How to explain the wierd mapping?
ILLUMINA-57021F_0001:1:36:16816:19386#0 0 chr2 174171054 3 10M86N30M * 0 0 GGAACAACAGATGGCTGCGCACCATCTCTGTGATTCTCTT CBCCCCC?CCCCC@C@==@@BCC8C><;?;;=?=A?CC?C NM:i:0 XS:A:- NH:i:2 CC:Z:= CP:i:174171054
ILLUMINA-57021F_0001:1:36:16816:19386#0 0 chr2 174171054 3 10M86N30M * 0 0 GGAACAACAGATGGCTGCGCACCATCTCTGTGATTCTCTT CBCCCCC?CCCCC@C@==@@BCC8C><;?;;=?=A?CC?C NM:i:0 XS:A:+ NH:i:2
ILLUMINA-57021F_0001:1:36:16816:19386#0 0 chr2 174171054 3 10M86N30M * 0 0 GGAACAACAGATGGCTGCGCACCATCTCTGTGATTCTCTT CBCCCCC?CCCCC@C@==@@BCC8C><;?;;=?=A?CC?C NM:i:0 XS:A:+ NH:i:2