Hello, im new here and i have a question about a sequencing problem we were getting.
For a project, we use Miseq and nano kit for doing...
20 results in 0.0031 seconds.
-
MiSEQ low diversity full Overlapping Paired end reverse read problems
-
Illumina MiSeq High cluster density, but low %PF problem
Hello everyone.
Please, I need a help with my MiSeq genome sequencing run. I am sequencing M. tuberculosis genomes using Nextera XT and... -
Shorter fragments than expected
My problem is having shorter fragments after sequencing than expected. The size of my library should be around 300 bp and I checked the size with Tape... -
MiSeq v3 kit for high diversity vs. low diversity libraries
Like many folks working on low diversity libraries, we have been hit hard by the problems associated with the V3 kit - lots of time and effort wasted.... -
Strange CRAMtools 2.1 issue
Hi all,
We have accumulated quite a lot of BAM files over the years and we would like (need) to archive the old(er) ones. We have tested... -
Problem for pindel2vcf to create vcf from from pindel-created _D files
I am New pindel user, and use ../pindel -f hg19.fasta -i p1_config.txt -c ALL -o P2_Index_95_P319 to create P2_Index_95_P319 with _SI, _D, and so on.... -
Time series issue,no time 0!
Hi everybody
I have encountered a problem during analysis of time series data.
I particular, in my data, I have 2 condition(in replicates)... -
MiSeq run with low Q30 and high cluster PF
Hi all,
Could anybody give me an idea or though on the following?
I made a run with the MiSeq using the TrueSeq LT kit and... -
MetaVelvet not running
Hi guys,
I have an issue with the metavelvet software (v1.2.02). I've followed the installation and usage manual accordingly, but when... -
Bowtie2 is unable to align query sequences that contain an intervening stretch of N's
If I have a reference sequence:
>reference
CTAGAATATCACTTAGGCCGGTATTCTATTACTGTACTTCGCGTAAGCTGCTTTAACCC
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN... -
ScriptSeq - 2nd peak @ 550bp
Hi
I have been preparing libraries from approx 400ng total RNA, mRNA enrichment, using the ScriptSeqV2 kit.
At the end I amplify with 12... -
miRDeep-p "problem in read format"
Hi!!
I am using miRDeep-p since 1 week and everything was OK until I execute the last script. In the manual this script is named miRDeep.pl,... -
blastn a list of sequences against themselves
Hello,
I have a small problem with blast. I'm trying to blast a set of sequences using the same set of sequences as the database, but there... -
assemble RNAseq data with Oases but so many transcripts in locus_1
Hello everyone
I'm doing transcriptome assembly work with Oases.
The illumina data's read length is 100nt and its quality is pretty... -
cuffdiff and limma, puzzled by the differences
Hi all, I've been using cuffdiff for a long time but recently I've given limma (voom) a try for RNA-seq data and compared the results.
The experiment...
