Gday all,
I am attempting to use SOAPsnpZ to call SNPs from SOLiD data that I aligned using SOAP2. After conducting the alignment I 'sorted'...
10 results in 0.0022 seconds.
-
SOAPsnpZ error : 'std::out_of_range'
Last edited by ashNZ; 10-09-2013, 06:21 AM. -
TMAP versus other aligners
Hi there,
I am working on some new data from Ion Proton and PGM as well. I was wondering if anyone had any experience comparing the alignment metrics... -
SOAP2 alignment problem
Hello there,
I tried SOAP2 to do alignments on paired-end data from illumina but the output was obviously wrong. Can anybody tell me where... -
Segmentation fault Error Soap2 mapping pairedend reads
Hello everybody,
we are a small team of Bioinformatitions working on some Illumina Paired end reads (HiSeq) (Fastq format)
... -
soap2 warning: length y <0 skip anyway
Hi all,
I have encountered a problem with soap2, when I would like to map my 17-30nt reads to genome (both fasta).
I used default parameters... -
Assemble Massive Datasets with Geneious Server
Next Generation Sequencing analysis just got a whole lot easier. The new scheduling tools in Geneious Server™ 1.1 coupled with the massive dataset handling... -
Geneious Server 1.1 Beta Now Available!
Geneious Server™ 1.1 Beta is now available and has several new algorithms as well as enhanced scheduling capabilities with the addition of Load Sharing... -
soap2 segmentation fault when loading index table
Hi all,
I try to use soap2 to align PE reads from HiSeq2000. Each read file is about 25GB. I have had very little luck with soap aligner.... -
soap2 PE results do not match bowtie or novoalign
Hi,
Here are the two fasta files:
cat 0000002435.1.fa
>0000002435
CTGGCCAACATGGTGAAACC
cat... -
Soap2 paired end mode
I have been trying to use the SOAP2 aligner in paired end mode with the following command:
...Code:./soap -a pair1.fastq -b pair2.fastq
