Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Why does mpileup skip my mutation ?

    (cross posted on biostar: http://biostar.stackexchange.com/questions/9961 )

    Hi all,

    I know, by capillary sequencing, that one of my samples contains a mutation at position:120458492.

    Some reads were aligned with bwa and I can clearly see my mutation using samtools tview.

    Code:
           120458491 120458501
    CCTGCTCTGGGGAGCTATGCCAGGATGGGTGCC
    ........R........................
    .....C..A..................C.....
    ........C. ......................
    ............  ...................
    ........A.....    ...............
    ,,,,,,,,a,,,,,,,,,,,,,,,,  ......
    ,,,,,,,,a,,,,,,,,,,,,,,,,,,,    .
    ........A........................
    ........A........................
    .............................C...
    ........A........................
    .................................
    ........A........................
    .................................
    .................................
    ........A........................
    ......................C..........
    ........A........................
    ,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,
    ........A........................
    .................................
     ................................
      ...............................
       .....A........................
          ,,,,,,,,,gg,,,,,,,,,,,t,,,,
           .A........................
            .........................
    however, we I call the mutations using samtools mpileup

    Code:
    ${SAMTOOLS}/samtools mpileup -uf  ${HG19} sample.bam |\
      ${SAMTOOLS}/bcftools/bcftools view  -bvcg - > snps.bcf
    ${SAMTOOLS}/bcftools/bcftools view  snps.bcf | gzip --best > snps.vcf.gz
    But I can't see the mutation in the VCF.

    here is the output of pileup (not mpileup):

    Code:
    (...)
    chr1    120458492   G   26  C.AaaAA.A.A..A.A,A...A,AA^].    JddfhQacfhhgggahehhhhaB[hg
    (...)
    How can I know why mpileup (or bcftools ?) skipped this mutation ?

    Thanks !

    Pierre

  • #2
    Try redoing mpileup with -Buf. That's worked for me. Like you, I observed that my sanger-verified mutation looked fine in pileup, but when I looked at it in the mpileup run without -B, the Baq calculations destroyed the quality scores of that locus, so it wouldn't call a SNP. Running it with -B should make your mpileup look like your pileup at that locus, and then the SNP will have high enough quality to be counted.

    Comment


    • #3
      That worked ! many thanks !

      Comment


      • #4
        try -E
        ...

        Comment

        Latest Articles

        Collapse

        • seqadmin
          Exploring the Dynamics of the Tumor Microenvironment
          by seqadmin




          The complexity of cancer is clearly demonstrated in the diverse ecosystem of the tumor microenvironment (TME). The TME is made up of numerous cell types and its development begins with the changes that happen during oncogenesis. “Genomic mutations, copy number changes, epigenetic alterations, and alternative gene expression occur to varying degrees within the affected tumor cells,” explained Andrea O’Hara, Ph.D., Strategic Technical Specialist at Azenta. “As...
          07-08-2024, 03:19 PM
        • seqadmin
          Exploring Human Diversity Through Large-Scale Omics
          by seqadmin


          In 2003, researchers from the Human Genome Project (HGP) announced the most comprehensive genome to date1. Although the genome wasn’t fully completed until nearly 20 years later2, numerous large-scale projects, such as the International HapMap Project and 1000 Genomes Project, continued the HGP's work, capturing extensive variation and genomic diversity within humans. Recently, newer initiatives have significantly increased in scale and expanded beyond genomics, offering a more detailed...
          06-25-2024, 06:43 AM

        ad_right_rmr

        Collapse

        News

        Collapse

        Topics Statistics Last Post
        Started by seqadmin, 07-19-2024, 07:20 AM
        0 responses
        119 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 07-16-2024, 05:49 AM
        0 responses
        105 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 07-15-2024, 06:53 AM
        0 responses
        103 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 07-10-2024, 07:30 AM
        0 responses
        43 views
        0 likes
        Last Post seqadmin  
        Working...
        X