Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Why does mpileup skip my mutation ?

    (cross posted on biostar: http://biostar.stackexchange.com/questions/9961 )

    Hi all,

    I know, by capillary sequencing, that one of my samples contains a mutation at position:120458492.

    Some reads were aligned with bwa and I can clearly see my mutation using samtools tview.

    Code:
           120458491 120458501
    CCTGCTCTGGGGAGCTATGCCAGGATGGGTGCC
    ........R........................
    .....C..A..................C.....
    ........C. ......................
    ............  ...................
    ........A.....    ...............
    ,,,,,,,,a,,,,,,,,,,,,,,,,  ......
    ,,,,,,,,a,,,,,,,,,,,,,,,,,,,    .
    ........A........................
    ........A........................
    .............................C...
    ........A........................
    .................................
    ........A........................
    .................................
    .................................
    ........A........................
    ......................C..........
    ........A........................
    ,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,
    ........A........................
    .................................
     ................................
      ...............................
       .....A........................
          ,,,,,,,,,gg,,,,,,,,,,,t,,,,
           .A........................
            .........................
    however, we I call the mutations using samtools mpileup

    Code:
    ${SAMTOOLS}/samtools mpileup -uf  ${HG19} sample.bam |\
      ${SAMTOOLS}/bcftools/bcftools view  -bvcg - > snps.bcf
    ${SAMTOOLS}/bcftools/bcftools view  snps.bcf | gzip --best > snps.vcf.gz
    But I can't see the mutation in the VCF.

    here is the output of pileup (not mpileup):

    Code:
    (...)
    chr1    120458492   G   26  C.AaaAA.A.A..A.A,A...A,AA^].    JddfhQacfhhgggahehhhhaB[hg
    (...)
    How can I know why mpileup (or bcftools ?) skipped this mutation ?

    Thanks !

    Pierre

  • #2
    Try redoing mpileup with -Buf. That's worked for me. Like you, I observed that my sanger-verified mutation looked fine in pileup, but when I looked at it in the mpileup run without -B, the Baq calculations destroyed the quality scores of that locus, so it wouldn't call a SNP. Running it with -B should make your mpileup look like your pileup at that locus, and then the SNP will have high enough quality to be counted.

    Comment


    • #3
      That worked ! many thanks !

      Comment


      • #4
        try -E
        ...

        Comment

        Latest Articles

        Collapse

        • seqadmin
          The Impact of AI in Genomic Medicine
          by seqadmin



          Artificial intelligence (AI) has evolved from a futuristic vision to a mainstream technology, highlighted by the introduction of tools like OpenAI's ChatGPT and Google's Gemini. In recent years, AI has become increasingly integrated into the field of genomics. This integration has enabled new scientific discoveries while simultaneously raising important ethical questions1. Interviews with two researchers at the center of this intersection provide insightful perspectives into...
          02-26-2024, 02:07 PM
        • seqadmin
          Multiomics Techniques Advancing Disease Research
          by seqadmin


          New and advanced multiomics tools and technologies have opened new avenues of research and markedly enhanced various disciplines such as disease research and precision medicine1. The practice of merging diverse data from various ‘omes increasingly provides a more holistic understanding of biological systems. As Maddison Masaeli, Co-Founder and CEO at Deepcell, aptly noted, “You can't explain biology in its complex form with one modality.”

          A major leap in the field has
          ...
          02-08-2024, 06:33 AM

        ad_right_rmr

        Collapse

        News

        Collapse

        Topics Statistics Last Post
        Started by seqadmin, Yesterday, 06:12 AM
        0 responses
        19 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 02-23-2024, 04:11 PM
        0 responses
        67 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 02-21-2024, 08:52 AM
        0 responses
        74 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 02-20-2024, 08:57 AM
        0 responses
        66 views
        0 likes
        Last Post seqadmin  
        Working...
        X