Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • stevebaeyen
    Member
    • Aug 2011
    • 18

    #1

    how to get IMAGE2 running ?

    I tried using IMAGE2 but there is no 'readme' or 'install' file and I can't find any information that explains how to install the software. I tried to run IMAGE2 on the example provided with the program, but after running the 10 iterations , the gaps seem not to be closed...
    This is what i did:
    I downloaded the Dec., 2 version (v2.3) from Sourceforge, copied the precompiled binaries to /usr/local/bin/ and made them executable on a Linux Ubuntu 11.10 64-bit workstation. I looked at the scripts run.sh and image.pl and saw some variables that have to be declared (such as paths to velvet, ssaha, etc.) but i still do not get the gaps closed in iteration 10 (i can mail the output to anybody willing to help).

    # software path
    # this is the path where the IMAGE path is
    # Please change it accordingly
    VELPATH=~/home/sbaeyen/Bio/IMAGE/IMAGE_version2/
    SSAHADIR=~/home/sbaeyen/Bio/IMAGE/IMAGE_version2/
    WALKPATH=~/home/sbaeyen/Bio/IMAGE/IMAGE_version2/
    Then i did:
    cd /home/sbaeyen/Bio/IMAGE/IMAGE_version2/example
    sbaeyen@PXLSEQ:~/Bio/IMAGE/IMAGE_version2/example$ home/sbaeyen/Bio/IMAGE/IMAGE_version2/image.pl -prefix 76bp -iteration 1 -all_iteration 10 -dir_prefix iteration > imagetest.txt
    When I run the 'image_run_summary.pl' script,
    sbaeyen@PXLSEQ:~/Bio/IMAGE/IMAGE_version2/example$ perl /home/sbaeyen/Bio/IMAGE/IMAGE_version2/image_run_summary.pl iteration, , I get:
    The prefix is : iteration
    iteration Starting_gaps Gap_closed Gap_extend_oneside Gap_extend_bothside
    1 5 0 0 0
    2 5 0 0 0
    3 5 0 0 0
    4 5 0 0 0
    5 5 0 0 0
    6 5 0 0 0
    7 5 0 0 0
    8 5 0 0 0
    9 5 0 0 0
    10 5 0 0 0
    Does anybody have a clue what i need to adapt to get this program running/what i did wrong?
    Best regards and thanks for any advice!
    Steve
    ps if you want i can send you the program output imagetest.txt
  • ians
    Member
    • Aug 2011
    • 53

    #2
    I don't know what the issue is (for release 2.3) but i got it to run somehow. I ran the command as you had and it failed. However, afterward I was able to make IMAGE2 run on the example dataset by deleting the ".noN.3000" off the end of the headers of the contigs:
    sed -i 's/\.noN\.3000//g' contigs.fa.original

    Here's the alignment:


    now to see if i can get this to work for SOAP alignments...
    Last edited by ians; 03-08-2012, 12:42 PM.

    Comment

    • vv85
      Member
      • Feb 2011
      • 17

      #3
      For the first tests with the new version , this fixed the problem for me:
      export PATH=$PATH:/blahblah/IMAGE_version2
      I did that before running the image.pl script and it fixed my problem. I'm not sure if it would help you.
      no error messages during the run? can you show me the output file?
      Also, I noticed you changed the run.sh. This was necessary in the previous version but I don't think it's necessary in this new one. Even if that's the case, the change you mentioned :
      VELPATH=~/home/sbaeyen/Bio/IMAGE/IMAGE_version2/
      would check /home/sbaeyen/home/sbaeyen .
      Of course, if in the output file you get something like "velvet found!" then it doesn't matter.

      Comment

      • ians
        Member
        • Aug 2011
        • 53

        #4
        test set not actual pairs?

        Took a look at the test set and both "pair" ends have the exact same sequence and header. 76bp_2.fastq headers don't even change the last 1 to a 2. Anyone know whats up with that?? Does image really just treat everything as frags? Yet running the test set closes gaps.

        ian@grid010:~/image-2.3/example$ head 76bp_1.fastq
        @Read.Salmonella_paratyphi_A_chromosome.29004.4835/1
        TCGTGTACAGCATTCTTTATAGTGGAACGGTGACCGTACCGCAAAGCTGCGAAATCAACGCCGGACAAACGATTCT
        +
        AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
        @Read.Salmonella_paratyphi_A_chromosome.29010.4836/1
        ACAGCATTCTTTATAGTGGAACGGTGACCGTACCGCAAAGCTGCGAAATCAACGCCGGACAAACGATTCTGGTGAA
        +
        AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
        @Read.Salmonella_paratyphi_A_chromosome.29016.4837/1
        TTCTTTATAGTGGAACGGTGACCGTACCGCAAAGCTGCGAAATCAACGCCGGACAAACGATTCTGGTGAATTTCGG
        ian@grid010:~/image-2.3/example$
        ian@grid010:~/image-2.3/example$
        ian@grid010:~/image-2.3/example$ head 76bp_2.fastq
        @Read.Salmonella_paratyphi_A_chromosome.29004.4835/1
        TCGTGTACAGCATTCTTTATAGTGGAACGGTGACCGTACCGCAAAGCTGCGAAATCAACGCCGGACAAACGATTCT
        +
        AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
        @Read.Salmonella_paratyphi_A_chromosome.29010.4836/1
        ACAGCATTCTTTATAGTGGAACGGTGACCGTACCGCAAAGCTGCGAAATCAACGCCGGACAAACGATTCTGGTGAA
        +
        AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
        @Read.Salmonella_paratyphi_A_chromosome.29016.4837/1
        TTCTTTATAGTGGAACGGTGACCGTACCGCAAAGCTGCGAAATCAACGCCGGACAAACGATTCTGGTGAATTTCGG

        Comment

        • aaronrjex
          Junior Member
          • Aug 2012
          • 7

          #5
          I've been running image2 with the following command:

          perl /media/Space1/Software/PAGIT/IMAGE/image.pl -scaffolds g7vrefA_split.fa -prefix g7_pairedreads_60 -iteration 1 -all_iteration 10 -dir_prefix ite -smalt_minScore 62 -kmer 71 -vel_ins_len 346 2> stdout &

          and it seems to be working fine for me.

          Although I notice that often times to rerun image (i.e., if you want to extend the number of iterations at a lower kmer) using 'restartIMAGE.pl' I have to delete the last iteration folder and run from the previous one (I don't know why).

          There is a nice publication in Nature Protocols this year by Swain et al that gives good step by step and trouble shooting advice.

          Comment

          • asurarocks
            Member
            • Nov 2010
            • 12

            #6
            Thanks Aaron, The review was very helpful!!

            Comment

            Latest Articles

            Collapse

            • SEQadmin2
              Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
              by SEQadmin2



              CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

              Despite this, “CRISPR helped turn genome editing from a specialized technique into
              ...
              07-31-2026, 11:01 AM
            • SEQadmin2
              Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
              by SEQadmin2


              Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

              The systematic characterization of the human proteome has
              ...
              07-20-2026, 11:48 AM

            ad_right_rmr

            Collapse

            News

            Collapse

            Topics Statistics Last Post
            Started by SEQadmin2, Yesterday, 10:05 AM
            0 responses
            8 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 08-13-2026, 12:22 PM
            0 responses
            33 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 08-11-2026, 10:35 AM
            0 responses
            27 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 08-06-2026, 07:41 AM
            0 responses
            38 views
            0 reactions
            Last Post SEQadmin2  
            Working...