Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • stevebaeyen
    Member
    • Aug 2011
    • 18

    how to get IMAGE2 running ?

    I tried using IMAGE2 but there is no 'readme' or 'install' file and I can't find any information that explains how to install the software. I tried to run IMAGE2 on the example provided with the program, but after running the 10 iterations , the gaps seem not to be closed...
    This is what i did:
    I downloaded the Dec., 2 version (v2.3) from Sourceforge, copied the precompiled binaries to /usr/local/bin/ and made them executable on a Linux Ubuntu 11.10 64-bit workstation. I looked at the scripts run.sh and image.pl and saw some variables that have to be declared (such as paths to velvet, ssaha, etc.) but i still do not get the gaps closed in iteration 10 (i can mail the output to anybody willing to help).

    # software path
    # this is the path where the IMAGE path is
    # Please change it accordingly
    VELPATH=~/home/sbaeyen/Bio/IMAGE/IMAGE_version2/
    SSAHADIR=~/home/sbaeyen/Bio/IMAGE/IMAGE_version2/
    WALKPATH=~/home/sbaeyen/Bio/IMAGE/IMAGE_version2/
    Then i did:
    cd /home/sbaeyen/Bio/IMAGE/IMAGE_version2/example
    sbaeyen@PXLSEQ:~/Bio/IMAGE/IMAGE_version2/example$ home/sbaeyen/Bio/IMAGE/IMAGE_version2/image.pl -prefix 76bp -iteration 1 -all_iteration 10 -dir_prefix iteration > imagetest.txt
    When I run the 'image_run_summary.pl' script,
    sbaeyen@PXLSEQ:~/Bio/IMAGE/IMAGE_version2/example$ perl /home/sbaeyen/Bio/IMAGE/IMAGE_version2/image_run_summary.pl iteration, , I get:
    The prefix is : iteration
    iteration Starting_gaps Gap_closed Gap_extend_oneside Gap_extend_bothside
    1 5 0 0 0
    2 5 0 0 0
    3 5 0 0 0
    4 5 0 0 0
    5 5 0 0 0
    6 5 0 0 0
    7 5 0 0 0
    8 5 0 0 0
    9 5 0 0 0
    10 5 0 0 0
    Does anybody have a clue what i need to adapt to get this program running/what i did wrong?
    Best regards and thanks for any advice!
    Steve
    ps if you want i can send you the program output imagetest.txt
  • ians
    Member
    • Aug 2011
    • 53

    #2
    I don't know what the issue is (for release 2.3) but i got it to run somehow. I ran the command as you had and it failed. However, afterward I was able to make IMAGE2 run on the example dataset by deleting the ".noN.3000" off the end of the headers of the contigs:
    sed -i 's/\.noN\.3000//g' contigs.fa.original

    Here's the alignment:


    now to see if i can get this to work for SOAP alignments...
    Last edited by ians; 03-08-2012, 12:42 PM.

    Comment

    • vv85
      Member
      • Feb 2011
      • 17

      #3
      For the first tests with the new version , this fixed the problem for me:
      export PATH=$PATH:/blahblah/IMAGE_version2
      I did that before running the image.pl script and it fixed my problem. I'm not sure if it would help you.
      no error messages during the run? can you show me the output file?
      Also, I noticed you changed the run.sh. This was necessary in the previous version but I don't think it's necessary in this new one. Even if that's the case, the change you mentioned :
      VELPATH=~/home/sbaeyen/Bio/IMAGE/IMAGE_version2/
      would check /home/sbaeyen/home/sbaeyen .
      Of course, if in the output file you get something like "velvet found!" then it doesn't matter.

      Comment

      • ians
        Member
        • Aug 2011
        • 53

        #4
        test set not actual pairs?

        Took a look at the test set and both "pair" ends have the exact same sequence and header. 76bp_2.fastq headers don't even change the last 1 to a 2. Anyone know whats up with that?? Does image really just treat everything as frags? Yet running the test set closes gaps.

        ian@grid010:~/image-2.3/example$ head 76bp_1.fastq
        @Read.Salmonella_paratyphi_A_chromosome.29004.4835/1
        TCGTGTACAGCATTCTTTATAGTGGAACGGTGACCGTACCGCAAAGCTGCGAAATCAACGCCGGACAAACGATTCT
        +
        AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
        @Read.Salmonella_paratyphi_A_chromosome.29010.4836/1
        ACAGCATTCTTTATAGTGGAACGGTGACCGTACCGCAAAGCTGCGAAATCAACGCCGGACAAACGATTCTGGTGAA
        +
        AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
        @Read.Salmonella_paratyphi_A_chromosome.29016.4837/1
        TTCTTTATAGTGGAACGGTGACCGTACCGCAAAGCTGCGAAATCAACGCCGGACAAACGATTCTGGTGAATTTCGG
        ian@grid010:~/image-2.3/example$
        ian@grid010:~/image-2.3/example$
        ian@grid010:~/image-2.3/example$ head 76bp_2.fastq
        @Read.Salmonella_paratyphi_A_chromosome.29004.4835/1
        TCGTGTACAGCATTCTTTATAGTGGAACGGTGACCGTACCGCAAAGCTGCGAAATCAACGCCGGACAAACGATTCT
        +
        AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
        @Read.Salmonella_paratyphi_A_chromosome.29010.4836/1
        ACAGCATTCTTTATAGTGGAACGGTGACCGTACCGCAAAGCTGCGAAATCAACGCCGGACAAACGATTCTGGTGAA
        +
        AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
        @Read.Salmonella_paratyphi_A_chromosome.29016.4837/1
        TTCTTTATAGTGGAACGGTGACCGTACCGCAAAGCTGCGAAATCAACGCCGGACAAACGATTCTGGTGAATTTCGG

        Comment

        • aaronrjex
          Junior Member
          • Aug 2012
          • 7

          #5
          I've been running image2 with the following command:

          perl /media/Space1/Software/PAGIT/IMAGE/image.pl -scaffolds g7vrefA_split.fa -prefix g7_pairedreads_60 -iteration 1 -all_iteration 10 -dir_prefix ite -smalt_minScore 62 -kmer 71 -vel_ins_len 346 2> stdout &

          and it seems to be working fine for me.

          Although I notice that often times to rerun image (i.e., if you want to extend the number of iterations at a lower kmer) using 'restartIMAGE.pl' I have to delete the last iteration folder and run from the previous one (I don't know why).

          There is a nice publication in Nature Protocols this year by Swain et al that gives good step by step and trouble shooting advice.

          Comment

          • asurarocks
            Member
            • Nov 2010
            • 12

            #6
            Thanks Aaron, The review was very helpful!!

            Comment

            Latest Articles

            Collapse

            • SEQadmin2
              Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
              by SEQadmin2


              Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.

              Probing...
              Today, 11:10 AM
            • SEQadmin2
              Cancer Drug Resistance: The Lingering Barrier to Rising Survival
              by SEQadmin2



              Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

              There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
              Yesterday, 05:17 AM
            • GATTACAT
              Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
              by GATTACAT
              Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
              07-01-2026, 11:43 AM

            ad_right_rmr

            Collapse

            News

            Collapse

            Topics Statistics Last Post
            Started by SEQadmin2, Today, 10:04 AM
            0 responses
            7 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, Yesterday, 10:08 AM
            0 responses
            6 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 07-07-2026, 11:05 AM
            0 responses
            9 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 07-02-2026, 11:08 AM
            0 responses
            31 views
            0 reactions
            Last Post SEQadmin2  
            Working...