Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • #31
    did anybody used the BS_SEEKER programme ??? it seems that its faster than BSMAP. I tried to run BSMAP and it really slow. is that normal... anyfeedbacks from the previous users ??

    Comment


    • #32
      I am copying a part of aligned read from BSMAP... Guys pease help how to interpret the methylation from here...... ur feedbacks will help me to have a clearer understanding of the data..

      Comment


      • #33
        I am copying a part of aligned read from BSMAP... Guys pease help how to interpret the methylation from here...... ur feedbacks will help me to have a clearer understanding of the data..




        WI-EAS209_0006_FC706VJ:1:1:4692:4450#0/1 GGAGTGATTGTAGTTATGAATTTGATATGTTATTATTATTGTTGTTTGTGTTTTTTTTTTTTTTTTTGTTTTGATTTGGGAAGACAGTT NM
        HWI-EAS209_0006_FC706VJ:1:1:4692:16063#0/1 GGAGTAAAAGGGTGAGAATTTATAGGAGGAATTTGTGGTCGATTAAATTTTTTTTTTTGGTTTTTTTTTGTTTTTGGGGGGGGGTTTAT NM
        HWI-EAS209_0006_FC706VJ:1:1:4692:4011#0/1 GGGTTACGGAAAGTATATTTTTTGTTTTTTTGGTTTTGTTTGTTTTTGTGTAGTTTTAATAAGTATAGAGTAAGGAATATAATCGGTTT UM gi|29824588|ref|NC_000017.5|NC_000017 6309095 ++ 1 0:1:0:0:0 mC:6309101:6309178
        HWI-EAS209_0006_FC706VJ:1:1:4693:4046#0/1 GGTAGGAGGATGGGGGGTTTTATATGGTTTTGTGTTATTTGTTTTATTTTTTTTTGTTTTTTGTGTGTTTTGTGGGGGAGGTTGGTTTT NM
        HWI-EAS209_0006_FC706VJ:1:1:4693:10086#0/1 GGTTTTTTGGTTTTGTTATTCGTTAGTTTGGTTTGTTTTTGGTGATAGGGGGGGGGGGGCGTTTTTTTTTGTTTTTTTTTTTTTTTTTT NM
        HWI-EAS209_0006_FC706VJ:1:1:4693:5806#0/1 GGAAGGTGTGGGTGGGTTGTTGATGGTGTTGTTTAGGGTATTTGGGGGTTTGAGATCGGAAGAGGGGTTCGGCGGGAATCCGGAGCCCG NM
        HWI-EAS209_0006_FC706VJ:1:1:4693:6145#0/1 GGATGTTGGGTTGTTTTTGGGGGTGGGTGGTGATTTGTGGGGTTTGGGTTGTGTTTTTTGGTTTTTTTTTTTTTTTTTTTTTTTTTTTT NM
        HWI-EAS209_0006_FC706VJ:1:1:4693:14513#0/1 GGATGATGTGTGGATTTTTGTGATTTTTGGGTTGGGATTTTTAATTGTTTGGGTTTTTTTGAGTTGGGAAGGGCGTTTCGGCGGGATTG NM
        HWI-EAS209_0006_FC706VJ:1:1:4693:16592#0/1 ATTAAAGAGGTTAGGTATGGTGGTTTATGTTTGTAATTTTAGTATTTTGGGAGGTTGTGGGGGTGGTTTTTGGGGTTTTGGTTTTAGGT NM
        HWI-EAS209_0006_FC706VJ:1:1:4693:2886#0/1 GGTTGGGGTAATTTAAAATTATATTTATTGGGTATATGTTTTTTTTTTTTTTTTATTTTGTTTTTTTTTTTGGTTGGTTTTTTTTTTGG NM
        HWI-EAS209_0006_FC706VJ:1:1:4693:11171#0/1 GGGAATTTTGTTTTGTATTGTTGTGTATTTGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGACCTCGTATTCTGTCTTCTGT NM
        HWI-EAS209_0006_FC706VJ:1:1:4693:11425#0/1 GGATTGCGGATTGTAGTGGCGTAATTTCGGTTTTTTGTAAGTTTCGTTTTTTGGGACCGGAAGGGCGGTTCGCGGGCATGCCGAGACCG NM
        HWI-EAS209_0006_FC706VJ:1:1:4693:16325#0/1 GGAAGGTTTAGAATTTTTCGTATAATTGTGGGGTTAGGAGATTCGTAATATAGGTTTTTTTGGTTGCGTTGGGTGTCTGGGTGGTTGGT NM
        HWI-EAS209_0006_FC706VJ:1:1:4693:18498#0/1 GGTAGTAGTTTTAGTGGTGTAGTTAGGTTATGGATATGTTTTTTTTTTTTTTTTTTTTTTTTTTTGTTTTTTTTTTTTTTTTTTTTTTT NM
        HWI-EAS209_0006_FC706VJ:1:1:4694:15719#0/1 GGTAATTATTGTTTGTTTTTTGGAGTTGTTGTTTGGGTAGGGGTGGTTTTGGTTTTTTTTTGTTTGGACGGGGAGGGGGGTTTGGGGGG NM
        HWI-EAS209_0006_FC706VJ:1:1:4694:15747#0/1 GGATTGGTGTTTGTTTAGGTTATTGTTTTTGTGTTTGGTGTTGGTGGCGGGGTTGAGATGGGAAGGGGGGTTCCGCGGGACTGCGGAGC NM
        HWI-EAS209_0006_FC706VJ:1:1:4694:20404#0/1 GGTTTTTTTTTTAAAAGTAGTTATGAGTAGATAAGTTTAGAAAGGGTTTTTTTTTCGTGTTTTTTTGGGGAAAATAGGGAAGGTTAATT NM
        HWI-EAS209_0006_FC706VJ:1:1:4694:8674#0/1 GGTTGGGTTTTAGGTTGGAGTATGGTTGAGTTTTGTTTTTGTTTTTTTATTTGTTGGGGGGGGATTAAGTTATGTTTTTTTTTGTGGTT NM
        HWI-EAS209_0006_FC706VJ:1:1:4694:19397#0/1 GGAGATTTTGGTTTTTTTAGGTTTTTTTTTGATTTAAATAAAAGTTGAGATCGGAAGAGCGGTTCAGCGGGAATGCCGAGCCCGTTTTG NM
        HWI-EAS209_0006_FC706VJ:1:1:4694:17742#0/1 GGAATGGGTTGTGTTTTTTTGTTTTATTTGATTTAGTTAATGAATGTTGAGTATTTTTTTTGTTTAGGGTTTTGGGTTGGGAGGGGGGT NM
        HWI-EAS209_0006_FC706VJ:1:1:4694:8920#0/1 GGGTTTAAGAGATTTTTTTGTTTTAGTTTTTTAAATAGTTGGGATTATAGGTATTTGTTTTTATGTTTGAGATCGGAAGAGCGGTTCAG NM
        HWI-EAS209_0006_FC706VJ:1:1:4695:6571#0/1 GGGGGTTTTAGATTTGAATTAGGTTCGTCGGTTTTTTGTTGGTTGGGGGTTTTGTTTGGGTTTTTTTTTTTTTTTTTTTTTTTTGGTTT NM
        HWI-EAS209_0006_FC706VJ:1:1:4695:5587#0/1 GGGAGTAGTTTTTTTTGTTTGTGTACGTTCGTATTTAGTAGATCGGAAGAGCGGTTCAGCAGAATGCCGAGACCGATCTCGTATCCCGT NM
        HWI-EAS209_0006_FC706VJ:1:1:4695:8464#0/1 GGAATTTGTTTTTTAGCGGAGATAATGAGTTTTATTTATTTAGTTTAGGTAAGTGTCGGTCGTGGGTGGGGTATTTTGGTTTTTTTTTT UM gi|29824582|ref|NC_000011.4|NC_000011 3109475 -+ 4 0:0:0:0:1 mC:3109547:3109507:3109503
        HWI-EAS209_0006_FC706VJ:1:1:4696:19770#0/1 GGGTATAGTGGTTTATATTTGTAATTTTAGTATTTTGGGAGGTTGAGGTAGGAAGATTATTTGAGTTTAGAAGAATAGTTCGGGTATTT UM gi|29824574|ref|NC_000003.5|NC_000003 45458886 -+ 2 0:0:1:0:0 mC

        Comment


        • #34
          hi is there any feedback on my above query....

          Comment


          • #35
            Hey. Welcome. Please don't constantly bump your thread. Give it some time and search the site for your answer.

            Comment


            • #36
              Hi aniruddha.otago,

              I am afraid I can't help you with interpreting the results from BSMAP, the output is probably described in the manual.

              However I would like to point out that we have developed a BS-Seq mapping program called Bismark, which is easy to use, runs very fast and it performs methylation calling (in CpG, CHG and CHG context) in addition to just aligning the reads. Thus, its output is easy to handle and interpret and doesn't require you to start programming before you can have a look at the methylation data.

              For more information please visit https://www.bioinformatics.bbsrc.ac....jects/bismark/ or search SEQanswers (and the SeqWiki) for Bismark.

              In case you need any help just drop me an email.

              Best wishes,
              Felix

              Comment


              • #37
                Hi felix,

                send you an email. Please reply.

                Comment


                • #38
                  You've got mail.

                  Kind regards,
                  Felix

                  Comment


                  • #39
                    Originally posted by sci_guy View Post
                    @lh3. I'm going to workshop over the next couple of days. It seems somebody else in my organisation has been using BSMAP with Arabidopsis bisulphite-Seq data. Below is their talk abstract. BSMAP would be particularly good for plant genomes considering all the CNG and CNN methylation. I'll see if I can get any slides.

                    "Hua Ying (CSIRO)
                    Approaches to mapping high-throughput bisulfite sequencing reads: High-throughput bisulfite sequencing is an attractive approach for analyzing genome-wide methylation patterns at a single-base-pair resolution. Although combining bisulfite conversion and high-throughput sequencing is increasingly widespread, its analysis is still problematic and limited to a few publications. A major challenge is the alignment of bisulfite-converted short reads to the reference genome due to increased search space and reduced sequence complexity as a result of the bisulfite conversion. Here, we took advantage of a recently published mapping algorithm BSMAP and demonstrated that BSMAP is more effective than previously used methods. By applying a two-step mapping strategy, we successfully mapped more than 90% of bisulfite short reads to the Arabidopsis genome."
                    Hi,there.You've mentioned "I'll see if I can get any slides.",and have you get the slides yet? If you have,Could you send a copy to me?I'm working on datas generated by BS_seq.THANKS!
                    Or could you give the e-mail adress of Hua Ying?My email:[email protected].

                    Comment


                    • #40
                      Hi,
                      I know this an old thread but I'd like to give an update on Novoalign bisulphite mode for those still interested.
                      Firstly Novoalign's algorithm is similar to BSMAP in that cytosines are retained in reads during alignment. The alignment works by converting Cs in the reference to CT dinucleotides just before alignment so a C or T in read will align with no penalty when aligned to a CT but Cs in read will mismatch a T in the reference. For negative strand alignments we do G to GA conversion.
                      In the next release V2.07.06 which should be out this week we've added a new program novomethyl that will call methylated cytosines from a SAM file. It's basically a samtools pileup with a SOAP SNP/Consensus calling algorithm that calls 6 nucelotide states (A, Cu, Cm, Gu, Gm, T ) rather than usual 4. Output is in form of a bed file.
                      To support this we also added a new tag in SAM format to indicate if read was aligned on Watson or Crick strand (i.e. in CT or GA mode)
                      If you'd like to try it we do give 1 month trial licences for free.
                      Colin
                      Novocraft Tech.

                      Comment


                      • #41
                        Hi Guys,

                        Recently we have published a paper in Nucleic Acids research on DNA methylation analysis- "Comparison of alignment software for genome-wide bisulphite sequence data". you might find it useful to have a look at it.. http://www.ncbi.nlm.nih.gov/pubmed/22344695

                        Comment

                        Latest Articles

                        Collapse

                        • seqadmin
                          Latest Developments in Precision Medicine
                          by seqadmin



                          Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

                          Somatic Genomics
                          “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
                          05-24-2024, 01:16 PM
                        • seqadmin
                          Recent Advances in Sequencing Analysis Tools
                          by seqadmin


                          The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
                          05-06-2024, 07:48 AM

                        ad_right_rmr

                        Collapse

                        News

                        Collapse

                        Topics Statistics Last Post
                        Started by seqadmin, 05-24-2024, 07:15 AM
                        0 responses
                        198 views
                        0 likes
                        Last Post seqadmin  
                        Started by seqadmin, 05-23-2024, 10:28 AM
                        0 responses
                        220 views
                        0 likes
                        Last Post seqadmin  
                        Started by seqadmin, 05-23-2024, 07:35 AM
                        0 responses
                        229 views
                        0 likes
                        Last Post seqadmin  
                        Started by seqadmin, 05-22-2024, 02:06 PM
                        0 responses
                        13 views
                        0 likes
                        Last Post seqadmin  
                        Working...
                        X