[Julien Roux]

Here is an answer to billstevens (many questions got intertwined):
It seems that you've already launched the tophat command (unsuccessfully) before, which led to the creation of an annotation.gtf.gff file from the annotation.gtf file. If you remove this file, the command should run smoothly.
Best,
Julien

[chrismit]

You can also just build them yourself:

gtf_to_fasta /home/chris/databases/refAnnotation.gtf /media/chris/human/Sequence/hg19.fa /home/chris/databases/refAnnotationout

bowtie2-build /home/chris/databases/refAnnotationout /home/chris/databases/refAnnotationbt

[Ajayi Oyeyemi]

The GTF file is fine. Yes, read the man page for ln. The target and the link parameters are separated by a space.

$ man ln

Dario...You are awesome! Thanks, I've finally got it to work.

[jsimba]

Bowtie error on tophat

You're not allowed to put filenames in the PATH variable. You put the path to the directory which contains those programs.

Dario,

I think there is a problem with the version of tophat for OSX seems that doesnt recognise bowtie2, I used this command:

rsb-33-073:tophat-2.0.7.OSX_x86_64 jaime$ ./tophat2 /Users/jaime/Desktop/bowtie2_indexes /Users/jaime/Desktop/RNAseq/inoculated_libraries

[2013-02-20 09:37:27] Beginning TopHat run (v2.0.7)
-----------------------------------------------
[2013-02-20 09:37:27] Checking for Bowtie
Bowtie 2 not found, checking for older version..
Error: Bowtie not found on this system.

I put the bowtie2 in the tophat directory and try to run from there but bowtie is not recognised by tophat

thanks

[Dario1984]

The GTF file is fine. Yes, read the man page for ln. The target and the link parameters are separated by a space.

$ man ln

[Dario1984]

even included bowtie2-build and bowtie2-inspect

You're not allowed to put filenames in the PATH variable. You put the path to the directory which contains those programs.

[Ajayi Oyeyemi]

Thanks Dario. Did I get the soft-linking of the genes.gtf file? and is there a space between genome* and .(full stop sign). Sorry I'm a newbie...

[Dario1984]

[2013-02-18 16:06:49] Checking for Bowtie index files
Error: Could not find Bowtie 2 index files (genome.*.bt2)

Your soft-linking command is wrong.

Instead of

$ ln -s ./Bos_taurus/NCBI/Btau_4.6.1/Sequence/Bowtie2Index/genome.*.

Use

$ ln -s ./Bos_taurus/NCBI/Btau_4.6.1/Sequence/Bowtie2Index/genome* .

Remember that soft-linking does not check that the target file exists, so you must make sure to get the syntax right. It won't give you any error if you make a mistake and link to a non-existent file.

[jsimba]

You need to have the path to the bowtie2 executable file in your PATH environment variable.

I did it before but doesnt work even included bowtie2-build and bowtie2-inspect

thanks

[Ajayi Oyeyemi]

That is not true. I downloaded bosTau7.fa and had a look at the beginning of the file with R.

> readLines("F:\\bosTau7.fa", n=10)
 [1] ">chr1"                                             
 [2] "taccccactcacacttatggatagatcaactaaacagaaaattaacaagg"
 [3] "aaaaaaaaaAAAAAAAAAACATGTATCTATAAAGCTCACTAAAGCAAAGC"
 [4] "ACAGTAAAATGAGGTATGGCAATAAAAGGCGTTAAATTTATCaaaaaaaa"
 [5] "aaaaaaaaagtgctgaaaaattaaaaaaaaaaaaaagaaaaaaaTATAGA"
 [6] "GATAAAATTAAATTTTTGTATTTATTCTTGCCGTTGAAAATTATGGGCAA"
 [7] "CTTTTCATTTTTTCAAATTTAATATTGTGTTACTCAAAAATACCCTAAAG"
 [8] "TTGATCTCTGTTTAAATCTAGAACACTTTTTGTTAAGTTTATGTCGATAT"
 [9] "GTCTTAGCTCTTTTTTTTAATTAGACATGATATTTTCTTTCATCACATTT"
[10] "TCAATATGTAGGAGAGCTAGTGATATTTGTGTAATAATTTTGTACTCGGC"

Note the first line. The chromosome naming style is the same as in the GTF file. Your problem is something else. You must show the exact error message you receive to get relevant help.

hanks Dario, let me be much more clearer. I downloaded the cow genome from the igenome in cufflinks website and I unpacked the tar.gz file. I created a link using the ln -s function to the gtf file and the genome. See below the result I got.

[ooa4@cbsum1c1b009 ooa4]$ ln -s ./Bos_taurus/NCBI/Btau_4.6.1/Sequence/Bowtie2Index/genome.*.
[ooa4@cbsum1c1b009 ooa4]$ ln -s ./Bos_taurus/NCBI/Btau_4.6.1/Annotation/Genes/genes.gtf
[ooa4@cbsum1c1b009 ooa4]$ ls -al
total 43380296
drwxrwxr-x 9 ooa4 ooa4 4096 Feb 18 16:05 .
drwxrwxrwx. 3 root root 4096 Feb 7 12:46 ..
drwxrwxr-x 3 ooa4 ooa4 4096 Feb 18 15:57 Bos_taurus
-rw-rw-r-- 1 ooa4 ooa4 27915273767 Feb 13 15:47 Bos_taurus_NCBI_Btau_4.6.1.tar.gz
-rw-rw-r-- 1 ooa4 ooa4 32225697 Feb 18 15:46 bovineee
lrwxrwxrwx 1 ooa4 ooa4 55 Feb 18 16:05 genes.gtf -> ./Bos_taurus/NCBI/Btau_4.6.1/Annotation/Genes/genes.gtf
lrwxrwxrwx 1 ooa4 ooa4 60 Feb 18 16:04 genome.*. -> ./Bos_taurus/NCBI/Btau_4.6.1/Sequence/Bowtie2Index/genome.*.
drwxrwxr-x 3 ooa4 ooa4 4096 Feb 12 16:31 index
drwxrwxr-x 3 ooa4 ooa4 4096 Feb 16 08:44 output1
drwxrwxr-x 3 ooa4 ooa4 4096 Feb 16 08:45 output1B
-rwxrwxr-x 1 ooa4 ooa4 5790 Mar 20 2012 README.txt
-rw-rw-r-- 1 ooa4 ooa4 6683898300 Feb 8 15:00 SRR594497.fastq
-rw-rw-r-- 1 ooa4 ooa4 995599407 Feb 8 11:48 SRR594497.sra
-rw-rw-r-- 1 ooa4 ooa4 7338744848 Feb 8 15:07 SRR594499.fastq
-rw-rw-r-- 1 ooa4 ooa4 1436256918 Feb 8 11:47 SRR594499.sra
drwxrwxr-x 4 ooa4 ooa4 4096 Feb 16 10:09 top_gtf
drwxr-xr-x 4 root root 4096 Feb 13 09:13 tophat_output2
drwxrwxr-x 3 ooa4 ooa4 4096 Feb 16 10:02 unique_output
-rw-rw-r-- 1 ooa4 ooa4 19337728 Feb 13 15:47 wget-log
[ooa4@cbsum1c1b009 ooa4]$ tophat2 -p 8 -G genes.gtf -o SRR594497_tophat genome SRR594497.fastq

[2013-02-18 16:06:49] Beginning TopHat run (v2.0.7)
-----------------------------------------------
[2013-02-18 16:06:49] Checking for Bowtie
Bowtie version: 2.0.6.0
[2013-02-18 16:06:49] Checking for Samtools
Samtools version: 0.1.18.0
[2013-02-18 16:06:49] Checking for Bowtie index files
Error: Could not find Bowtie 2 index files (genome.*.bt2)

I'm using the trapnell protocol and I'm following it to the letter.
Any advice?

[Dario1984]

You need to have the path to the bowtie2 executable file in your PATH environment variable.

[jsimba]

Bowtie error on tophat

Hi everyone,

Im new in RNA seq data analysis Im just learning how to install tophat, bowtie and so on, doing the troubleshooting of tophat recommended by their website I obtain this:

2013-02-18 16:10:51] Checking for Bowtie
Bowtie 2 not found, checking for older version..
Error: Bowtie not found on this system.

the line that I used is this:

./tophat -r 20 test_ref reads_1.fq reads_2.fq

Prevously I Installed bowtie2 and guessed only to change bowtie files to tophat directory was enough but doesnt work so what should I do??

Thanks

[Dario1984]

That is not true. I downloaded bosTau7.fa and had a look at the beginning of the file with R.

> readLines("F:\\bosTau7.fa", n=10)
 [1] ">chr1"                                             
 [2] "taccccactcacacttatggatagatcaactaaacagaaaattaacaagg"
 [3] "aaaaaaaaaAAAAAAAAAACATGTATCTATAAAGCTCACTAAAGCAAAGC"
 [4] "ACAGTAAAATGAGGTATGGCAATAAAAGGCGTTAAATTTATCaaaaaaaa"
 [5] "aaaaaaaaagtgctgaaaaattaaaaaaaaaaaaaagaaaaaaaTATAGA"
 [6] "GATAAAATTAAATTTTTGTATTTATTCTTGCCGTTGAAAATTATGGGCAA"
 [7] "CTTTTCATTTTTTCAAATTTAATATTGTGTTACTCAAAAATACCCTAAAG"
 [8] "TTGATCTCTGTTTAAATCTAGAACACTTTTTGTTAAGTTTATGTCGATAT"
 [9] "GTCTTAGCTCTTTTTTTTAATTAGACATGATATTTTCTTTCATCACATTT"
[10] "TCAATATGTAGGAGAGCTAGTGATATTTGTGTAATAATTTTGTACTCGGC"

Note the first line. The chromosome naming style is the same as in the GTF file. Your problem is something else. You must show the exact error message you receive to get relevant help.

[Ajayi Oyeyemi]

index and gtf conflict.

See the pattern in the error message. It ends with bt2. They don't have the cow index on their website, so you will have to make it.

Hi,
I downloaded the bovine genome from this site http://hgdownload.soe.ucsc.edu/golde...sTau7/bigZips/ and I used the bowtie2-build to construct my index files. However, my gtf file was also downloaded from this site http://genome.ucsc.edu/cgi-bin/hgTables ( I used the latest version BaylorBtau_4.6.1/bosTau7). I faced a lot of problems during alignment with tophat and someone mentioned that chromosome numbering differs( for genome is 1 and for the gtf file chr 1). I don't know how to fix this. Can someone point out where I can get a gtf file that is compatible the site I got my genome from?

Please I really need your help as I'm new to rna-seq data analysis.

Thanks.

[Dario1984]

Error: Could not find Bowtie 2 index files (/home/workdir/ooa4/rnaseq/.*.bt2)

See the pattern in the error message. It ends with bt2. They don't have the cow index on their website, so you will have to make it.