Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Strange Results After maq2sam-long

    Hi all,

    I've been working with bwa, maq and samtools for a few weeks now, and my PI just came across an unusual result which now has me worried about my results. I started off my workflow by running MAQ on a data set and matching against a restricted chromosomal region of hg18. I now have output with an example as follows:

    HWUSI-EAS211R_5:2:6:90:1384 131 chr9_22054888_22134171 1 99 35M * 0 172 ATCCTTGGAGTTGTGAGGATTTAATGCAATTGTCT WWWWWWWWWWWWWWWWWVWWWWWWWUWWWVUUUUT MF:i:18 AM:i:99 SM:i:99 NM:i:1 UQ:i:30 H0:i:1 H1:i:0

    My question is this: what is going on with the tags NM, H0 and H1 (in bold above). NM:i:1 should mean that the read has one mismatch to the genome, which seems to be true if I blat back to the reference. However H0:i:1 should mean that there is an exact match to the genome, and H1:i:1 should mean that there are no matches with distance 1 from the reference. Am I misinterpreting the tags or is this really inconsistent? If it is inconsistent, where is the bug (MAQ or maq2sam-long) and how can I fix it?

    --Will

  • #2
    Tags NM, H0 and H1 are quite confusing, I discuss it in this thread, please take a look,
    Discussion of next-gen sequencing related bioinformatics: resources, algorithms, open source efforts, etc


    The read you listed above could be interpreted in two ways:
    NM:i:1 H0:1:1 H1:i:0
    1. Unique mapping has 1 mismatch, the number of hit with no mismatch is 1, the number of hit with 1 mismatch is 0. NM field contradicts H0 field.

    2. Unique mapping has 1 mismatch, the number of hits of best hit is 1, the number of suboptimal hits with 1 more mismatch is 0. This is explainable.

    However, I 've come across this as well:
    MF:i:32 AM:i:47 NM:i:2 UQ:i:60 H0:i:0 H1:i:1

    According to the second explanation, H0 should be 1, and the best hit has 2 mismatches. I may not consent this is a bug of maq or maq2sam-long, but the ambiguous definition of tags.

    Comment


    • #3
      I agree that this is abiguous, but looking at the documentation is even more concerning. NM, by this definition, should refer to the particular alignment being reported not just to unique alignments. In this case the H1:i:0 tag is a misreport, because it implies that there are no reads with 1-difference from the reference, but simultaneously is itself reporting a read 1-difference from the reference.

      See: http://samtools.sourceforge.net/SAM1.pdf - page 7

      Comment


      • #4
        It still mixed me up, I thought NM (edit distance) is more or less similar to "number of mismatches of the best hit" defined in MAQ manual. I ever parsed the maq output (.map) file, the distribution of field "number of mismatches of the best hit" I count is exactly same as the distribution I count for NM tag from the sam file converted by same map file.

        Comment


        • #5
          Yea I am getting the same result. I think that's because maq2sam-long is returning only the best hit when it outputs in SAM format, so NM is equal to the number of matches in the best hit AND that hit. Clearly NM is consistent with the entire rest of the line. However H1:i and H0:i are not, and I believe need fixing in maq2sam-long or in maq (but probably not in maq)

          Comment

          Latest Articles

          Collapse

          • seqadmin
            Recent Advances in Sequencing Analysis Tools
            by seqadmin


            The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
            Today, 07:48 AM
          • seqadmin
            Essential Discoveries and Tools in Epitranscriptomics
            by seqadmin




            The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...
            04-22-2024, 07:01 AM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by seqadmin, Today, 07:17 AM
          0 responses
          11 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 05-02-2024, 08:06 AM
          0 responses
          19 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 04-30-2024, 12:17 PM
          0 responses
          20 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 04-29-2024, 10:49 AM
          0 responses
          28 views
          0 likes
          Last Post seqadmin  
          Working...
          X