Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Software like REPuter

    Hi,

    Do you know a free software like REPuter for find and visualise repeat sequences?
    Thanks

  • #2
    By repeat structures, I assume you mean transposable elements? If so, there are more sophisticated programs to predict both Class I and Class II TEs based on structure and domain architecture. Tell us what you want to find so that we can make suggestions. The general topic of repeat finding is so broad that it would be hard to start listing programs without a better idea of what you are trying to do. Also, the visualization offered by that program is pretty crude. What type of visualization did you have in mind?

    Comment


    • #3
      Hi!
      I'm working on de novo chloroplast genome, and there are a lot of little repeated sequences.
      For exemple, REPuter can find all little repeated sequences who have more than 30 nucleotid. This is an output example:
      Code:
      >Sequence1
      tcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtatt
      >Sequence2
      tcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtatt
      >Sequence3
      tcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtatt
      >Sequence4
      tcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtatt
      >Sequence5
      tcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtatt
      >Sequence6
      tcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtatt
      >Sequence7
      tcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtatt
      >Sequence8
      aggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagagga
      >Sequence9
      tcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtatt
      >Sequence10
      aggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagagga
      >Sequence11
      tcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtatt
      >Sequence12
      aggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagagga
      >Sequence13
      aggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagagga
      >Sequence14
      tcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtatt
      >Sequence15
      aggaacttctcgaccgtatgggagaggaacttctcgaccgtatgggagaggaacttctcgaccgtatgggagaggaacttctcgaccgtatgggagaggaacttctcgaccgtatgggagaggaacttctcgaccgtatgggagaggaacttctcgaccgtatgggagaggaacttctcgaccgtatgggagaggaacttctcgaccgtatgggagaggaacttctcgaccgtatgggagaggaacttctcgaccgtatgggagaggaacttctcgaccgtatgggagaggaacttctcgaccgtatgggagag
      >Sequence16
      aggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagaggatgagcatagcgaatactcgtcagagga
      >Sequence17
      aggaacttctcgaccgtatgggagaggaacttctcgaccgtatgggagaggaacttctcgaccgtatgggagaggaacttctcgaccgtatgggagaggaacttctcgaccgtatgggagaggaacttctcgaccgtatgggagaggaacttctcgaccgtatgggagaggaacttctcgaccgtatgggagaggaacttctcgaccgtatgggagaggaacttctcgaccgtatgggagaggaacttctcgaccgtatgggagaggaacttctcgaccgtatgggagag
      >Sequence18
      tcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtattacatgcgtagcatgtattcctctcattcttcgagtatt
      >Sequence19
      There are other kind of output file. After, I can use REPEATmasker for mask all repeated sequences in my genome and know what is pourcentage of it. What I mean by ''visualise'', it's the density of repeated sequences, for exemple:
      http://t1.gstatic.com/images?q=tbn:A...DXF8fmO8LizSEu

      Thanks!

      Comment


      • #4
        There are no transposable elements in the chloroplast genome, but there are large (and probably numerous small) tandem repeats. One idea would be to just calculate the density of repeats across the genome and plot that as a histogram. I have done this for looking at the tandem repeats in chloroplast genomes.

        Comment


        • #5
          Thanks for you answer! Do you know a software for do this?

          Comment


          • #6
            Originally posted by Antony03 View Post
            Thanks for you answer! Do you know a software for do this?
            You could use TRF or Vmatch or any number of tools to find the repeats. From there it may take a little scripting so you can plot the repeat density in R (or any other plotting program).

            Comment

            Latest Articles

            Collapse

            • seqadmin
              Latest Developments in Precision Medicine
              by seqadmin



              Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

              Somatic Genomics
              “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
              05-24-2024, 01:16 PM
            • seqadmin
              Recent Advances in Sequencing Analysis Tools
              by seqadmin


              The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
              05-06-2024, 07:48 AM

            ad_right_rmr

            Collapse

            News

            Collapse

            Topics Statistics Last Post
            Started by seqadmin, Yesterday, 01:32 PM
            0 responses
            10 views
            0 likes
            Last Post seqadmin  
            Started by seqadmin, 05-24-2024, 07:15 AM
            0 responses
            199 views
            0 likes
            Last Post seqadmin  
            Started by seqadmin, 05-23-2024, 10:28 AM
            0 responses
            221 views
            0 likes
            Last Post seqadmin  
            Started by seqadmin, 05-23-2024, 07:35 AM
            0 responses
            232 views
            0 likes
            Last Post seqadmin  
            Working...
            X