/home/populus/samtools-0.1.5c_x86_64-linux/samtools import ../../../baohua/junction_seq/junction.fasta junction.sam junction.bam
[sam_read1] reference '430624:LG_XIII:729449:k:-:726374:727070' is recognized as '*'.
[sam_read1] reference '54520:LG_I:176232:k:-:30091625:30091707' is recognized as '*'.
[sam_read1] reference '506510:LG_XV:575307:k:+:6855591:6855793' is recognized as '*'.
[sam_read1] reference '226729:LG_V:831614:k:+:15226096:15226268' is recognized as '*'.
[sam_read1] reference '376715:LG_X:659725:k:+:18189304:18189397' is recognized as '*'.
[sam_read1] reference '295575:LG_VII:820087:k:-:11650209:11652931' is recognized as '*'.
[sam_read1] reference '85609:LG_II:816476:k:+:9499617:9500162' is recognized as '*'.
[sam_read1] reference '81316:LG_II:830246:k:-:7504961:7505095' is recognized as '*'.
[sam_read1] reference '216556:LG_V:559021:k:+:8094269:8094443' is recognized as '*'.
[sam_read1] reference '143501:LG_III:711772:k:+:17770176:17770263' is recognized as '*'.
[sam_read1] reference '444063:LG_XIII:571390:k:+:6586727:6586835' is recognized as '*'.
This is the reference file:
>1:LG_I:639579:k:-:11064:13299
TTCACATTACTGCTACATTTCATATCTGGGATTCACCCTAGATGCCTCTTGCAAAAGTCAGTGACGTATCGCGATCCATTGTAGAAAATG
>2:LG_I:639579:n:-:11064:13481
TTCACATTACTGCTACATTTCATATCTGGGATTCACCCTAGATGCTGAAAAGACAACGCTCCCACCAATCCAACATGAAAAGTCCAAAAG
>3:LG_I:639579:n:-:11064:14624
TTCACATTACTGCTACATTTCATATCTGGGATTCACCCTAGATGCCTGAGGGAGTACTTGCAAAAAGATGGAAAATTTCGGAGAAAAAGT
Does the length of reference sequence''s name is too long?
When i finish convert to bam, then sort the bam and view the new sam file.
the reference name are all *
[sam_read1] reference '430624:LG_XIII:729449:k:-:726374:727070' is recognized as '*'.
[sam_read1] reference '54520:LG_I:176232:k:-:30091625:30091707' is recognized as '*'.
[sam_read1] reference '506510:LG_XV:575307:k:+:6855591:6855793' is recognized as '*'.
[sam_read1] reference '226729:LG_V:831614:k:+:15226096:15226268' is recognized as '*'.
[sam_read1] reference '376715:LG_X:659725:k:+:18189304:18189397' is recognized as '*'.
[sam_read1] reference '295575:LG_VII:820087:k:-:11650209:11652931' is recognized as '*'.
[sam_read1] reference '85609:LG_II:816476:k:+:9499617:9500162' is recognized as '*'.
[sam_read1] reference '81316:LG_II:830246:k:-:7504961:7505095' is recognized as '*'.
[sam_read1] reference '216556:LG_V:559021:k:+:8094269:8094443' is recognized as '*'.
[sam_read1] reference '143501:LG_III:711772:k:+:17770176:17770263' is recognized as '*'.
[sam_read1] reference '444063:LG_XIII:571390:k:+:6586727:6586835' is recognized as '*'.
This is the reference file:
>1:LG_I:639579:k:-:11064:13299
TTCACATTACTGCTACATTTCATATCTGGGATTCACCCTAGATGCCTCTTGCAAAAGTCAGTGACGTATCGCGATCCATTGTAGAAAATG
>2:LG_I:639579:n:-:11064:13481
TTCACATTACTGCTACATTTCATATCTGGGATTCACCCTAGATGCTGAAAAGACAACGCTCCCACCAATCCAACATGAAAAGTCCAAAAG
>3:LG_I:639579:n:-:11064:14624
TTCACATTACTGCTACATTTCATATCTGGGATTCACCCTAGATGCCTGAGGGAGTACTTGCAAAAAGATGGAAAATTTCGGAGAAAAAGT
Does the length of reference sequence''s name is too long?
When i finish convert to bam, then sort the bam and view the new sam file.
the reference name are all *