Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Nucleotides M and R in human reference no. 37

    A, C, G and T are "normal" nucleotides and N represents unknown nucleotides in repetitive sequences or SNPs. When checking the reference genome from 1KGP, I found these odd nucleotides: M and R. Does anybody know anything about that?

    Code:
    >>> ref_f = open("human_g1k_v37.fasta", "r")
    >>> 
    >>> cnt = 0
    >>> 
    >>> for i in ref_f:
    ...     cnt += 1
    ...     if i[0] == ">":
    ...             print i, 
    ...             continue
    ...     
    ...     n = i.count("A") + i.count("C") + i.count("G") + i.count("T") + i.count("N")
    ...     
    ...     if n < len(i) - 1:
    ...             print cnt, i
    yields

    Code:
    ...
    >3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
    9221347 CGCTACATAGCTGMCTTATTATTCGTGGTCCCCTATGACCCCCTGATCATTTTCCCTGAG
    9221351 CCRRGCTTGGTTCTAACAATGAATTTAATAAGAATTGTATTTAATCAATGTTTAAATATA
    ...

  • #2
    Hi!
    I'm not working with Human genome, but is it not the IUPAC annotation for alternative bases (as S for Strong if G or C)? The wiki page here http://en.wikipedia.org/wiki/Nucleic_acid_notation

    Comment


    • #3
      Thanks. That is what I needed to know.

      Comment

      Latest Articles

      Collapse

      • seqadmin
        The Impact of AI in Genomic Medicine
        by seqadmin



        Artificial intelligence (AI) has evolved from a futuristic vision to a mainstream technology, highlighted by the introduction of tools like OpenAI's ChatGPT and Google's Gemini. In recent years, AI has become increasingly integrated into the field of genomics. This integration has enabled new scientific discoveries while simultaneously raising important ethical questions1. Interviews with two researchers at the center of this intersection provide insightful perspectives into...
        02-26-2024, 02:07 PM
      • seqadmin
        Multiomics Techniques Advancing Disease Research
        by seqadmin


        New and advanced multiomics tools and technologies have opened new avenues of research and markedly enhanced various disciplines such as disease research and precision medicine1. The practice of merging diverse data from various ‘omes increasingly provides a more holistic understanding of biological systems. As Maddison Masaeli, Co-Founder and CEO at Deepcell, aptly noted, “You can't explain biology in its complex form with one modality.”

        A major leap in the field has
        ...
        02-08-2024, 06:33 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by seqadmin, 02-28-2024, 06:12 AM
      0 responses
      24 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 02-23-2024, 04:11 PM
      0 responses
      70 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 02-21-2024, 08:52 AM
      0 responses
      79 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 02-20-2024, 08:57 AM
      0 responses
      69 views
      0 likes
      Last Post seqadmin  
      Working...
      X