[GenoMax]

So your bamtools executable is probably in bin directory. Can you show us output of

$ ls -lh /home/bg/repeatseq-master/bamtools/bin

In that case you PATH needs to be changed to

$ PATH="/home/bg/repeatseq-master/bamtools/bin:$PATH"

[basalganglia]

$ ls -lh /home/bg/repeatseq-master/bamtools/bin
total 704K
lrwxrwxrwx 1 bg bg 14 May 28 00:08 bamtools -> bamtools-2.3.0
-rwxrwxr-x 1 bg bg 703K May 28 00:08 bamtools-2.3.0

then I will try,

$ PATH="/home/bg/repeatseq-master/bamtools/bin:$PATH"
$ export PATH
$ which bamtools
~/repeatseq-master/bamtools/bin/bamtools
$
$ cd repeatseq-master/
[bg@dsas2 repeatseq-master]$ repeatseq
-bash: repeatseq: command not found
[bg@dsas2 repeatseq-master]$ echo $PATH
/home/bg/repeatseq-master/bamtools/bin:/home/bg/repeatseq-master/bamtools:/home/bg/repeatseq-master/bamtools:/home/bg/repeatseq-master/bamtools:/usr/lib64/qt-3.3/bin:/usr/local/bin:/bin:/usr/bin:/usr/local/sbin:/usr/sbin:/sbin:/opt/jdk1.7.0_71/bin:/home/bg/bin
[bg@dsas2 repeatseq-master]$ which bamtools
~/repeatseq-master/bamtools/bin/bamtools
[bg@dsas2 repeatseq-master]$ chmod u+x repeatseq
[bg@dsas2 repeatseq-master]$ repeatseq
-bash: repeatseq: command not found
[bg@dsas2 repeatseq-master]$ ./repeatseq
./repeatseq: error while loading shared libraries: libbamtools.so.2.3.0: cannot open shared object file: No such file or directory

I dont understand whats the problem !!

[GenoMax]

As the author describes on this page:https://github.com/adaptivegenome/re...25a5417b200e70

Try this:

$ LD_LIBRARY_PATH="/home/bg/repeatseq-master/bamtools/bin:/home/bg/repeatseq-master/bamtools:$LD_LIBRARY_PATH"
$ export LD_LIBRARY_PATH

[deyler]

persistence

You're getting closer so don't give up.

You messed with your LD_LIBRARY_PATH in the beginning. But you didn't put the full path to the bamtools executable in it. Genomax is saying to try that again, but this time make sure you include the "/bin" part of /repeatseq-master/bamtools/bin, because that's where the bamtools executable actually lives.

I do not really understand this either. Perhaps Genomax can clarify - is LD_LIBRARY_PATH required to be set when you build repeatseq and bamtools, or does it just need to be set when repeatseq is run? Mine is not set and repeatseq runs fine.

[basalganglia]

I suppose that when I write "repeatseq" program can work or I should add files as bam, fasta and region file.

These are my last effort ;

~]$ cd repeatse
repeatseq]$ export LD_LIBRARY_PATH=$LD_LIBRARY_PATH:/home/bg/repeatseq/bamtools/bin
repeatseq]$ repeatseq
-bash: repeatseq: command not found
repeatseq]$ which bamtools
/usr/bin/which: no bamtools in (/usr/lib64/qt-3.3/bin:/usr/local/bin:/bin:/usr/bin:/usr/local/sbin:/usr/sbin:/sbin:/opt/jdk1.7.0_71/bin:/home/bg/bin)
repeatseq]$ export PATH=$PATH:/home/bg/repeatseq/bamtools/bin
[ repeatseq]$ repeatseq
-bash: repeatseq: command not found
repeatseq]$ which bamtools
~/repeatseq/bamtools/bin/bamtools
repeatseq]$ LD_LIBRARY_PATH="/home/bg/repeatseq/bamtools/bin:/home/bg/repeatseq/bamtools:$LD_LIBRARY_PATH"
repeatseq]$ which bamtools
~/repeatseq/bamtools/bin/bamtools
repeatseq]$ repeatseq
-bash: repeatseq: command not found
repeatseq]$ ./repeatseq
./repeatseq: error while loading shared libraries: libbamtools.so.2.3.0: cannot open shared object file: No such file or directory
repeatseq]$ chmod u+x repeatseq
repeatseq]$ ./repeatseq
./repeatseq: error while loading shared libraries: libbamtools.so.2.3.0: cannot open shared object file: No such file or directory
repeatseq]$ repeatseq
-bash: repeatseq: command not found

[basalganglia]

I have download repatse-master, bamtools and fastahack again and then did all instructions that are written in INSTALL.

When I write make code for bamtools file , I have seen that

Linking CXX executable ../../../bin/bamtools,

Is there any error related with this ?

More thanks I cant give up!

[GenoMax]

Can you exactly issue the commands in post #18? Please copy and paste the commands into your terminal (if you do that then do not include the initial $ when you copy, that is the system prompt in the example).

[deyler]

You need to understand at least a little bit about what you're doing, which is what Genomax tried to tell you once already. It's clear from your terminal dumps that you are manually setting things every time you log in. Sometimes you mistype things, other times you forget to export the environmental variable after setting it.

So: before you type the word "repeatseq" again, go immediately to the link Genomax posted earlier, and spend a couple hours going through the bash tutorial. Otherwise you're just a monkey banging away at a keyboard hoping to write a novel by chance. (That's a reference to an English-language proverb, I'm not calling you a monkey.)

Then, once you know what environmental variables are and how to set them automatically on login, come back and try again.

I am no Unix/BASH expert. But if you want to do this stuff, you have to invest a little in developing your own skills.

Now:

This guy has posted notes on installing bamtools. He had to set LD_LIBRARY_PATH.
link

I note that his libbamtools.so.2.3.0 file was in /usr/local/lib. So I wonder if yours is not in the directories you're adding to LD_LIBRARY_PATH. You have to find libbamtools.so.2.3.0 before you can tell the system where to look for it.

[basalganglia]

Thank you for your help !!!

At the end it works !!!!

[deyler]

Good, glad you got it running. In my experience it is too sensitive. I ended up writing a custom script to call things because we have zero tolerance for false positives.

[basalganglia]

Now, I have another problem;

To create region file with Tandem Repeats Finder, I have convert BAM file to fasta file with samtools.
Fasta file includes;

>HISEQ:124:H87LAADXX:1:2211:17562:14447
ACCCTACCCCCACCCTCACCCTCACCCCCACCCCCACCCCAACCCCAAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCCTAACCCTAACCCTAA ( I dont understand where is chromosome)

then when I use Tandem Repat result is like that ;

@HISEQ:124:H87LAADXX:2:2214:1727:13172
4 109 40 2.7 41 86 5 146 13 33 37 15 1.86 GGCTCCCTCACTTCTCAGACGGGGCGGCTGCCCGGCAGAGG GGCTCCTCACTTATCAGACGGGGCGGCTGTCGGGCGGAGGGGCCCCTCACTTCTCAGACGGGGCGGCTGCCCGGCAGAGGGGCTCCCCACTTCTCAGACAGGGCGG AGA G (Where is chromosome number again, it is still working, not finished)

So Should I use another convert file to see chr number ?

[deyler]

This thing:

>HISEQ:124:H87LAADXX:1:2211:17562:14447
ACCCTACCCCCACCCTCACCCTCACCCCCACCCCCACCCCAACCCCAAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCCTAACCCTAACCCTAA

is a fastq format file. It's the output of the sequencing read from the sequencer. There is no associated chromosome number because it's not aligned to a genome.

You have asked Tandem Repeat Finder to find tandem repeats in each of your sequencing reads, pretending that each of your sequencing reads is its own chromosome. The output is:

@HISEQ:124...etc.
[numbers] [sequences]

where @HISEQ:124:...etc. is the chromosome number.

So to put it succinctly - you're doing it wrong. The workflow is like this:

1) take your reads (your fastq files) and align them to a reference genome sequence (fasta file) with some aligner (bowtie2, bwa, Novoalign, etc.)
2) take your reference genome file (the fasta file you aligned to) and run Tandem Repeat Finder on it
3) reformat the TRF .ngs file from step 2 to be the format that RepeatSeq wants
3) run repeat seq on the reformatted file from step 3 and the bamfiles from step 1