Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • How to run HTSeq with paired end file

    I have one paired end SAM file generated by Novoalign. The two ends of one pair share the same read ID, but the HTSeq reports all of them as "alignment_not_unique" and ignores them. Anybody know how to fix this issue? I used the following command,

    htseq-count --stranded=no --mode=intersection-nonempty -t exon -i gene_id inputFile.sam Homo_sapiens.GRCh37.67.chr.gtf > inputFile.htseq.count

    The following are 4 example reads.

    HWI-ST1189:59:C1305ACXX:5:1101:10000:108281 99 chrM 7910 3 51M = 8156 0 CGAGTACACCGACTACGGCGGACTAATCTTCAACTCCTACA
    TACTTCCCCC CCCFFFFFHHHHHJJJJJIJJJJIIJJIJJJJJJJIIHFHHHHFFFFFFED PG:Z:novoalignMPI NH:i:2 HI:i:1 AM:i:70 NM:i:0 SM:i:70 GN:Z:585 T
    N:Z:ENST00000361739 ZN:i:2 PQ:i:6 UQ:i:6 AS:i:6 ZS:Z:R
    HWI-ST1189:59:C1305ACXX:5:1101:10000:108281 147 chrM 8156 3 51M = 7910 0 GGTATACTACGGTCAATGCTCTGAAATCTGTGGAGCAAACC
    ACAGTTTCAT IJJJHIJJIJJJJIJJJJJJJJJJJIIJJJJJJJJIIIHHHHHFFFFFCCC PG:Z:novoalignMPI NH:i:2 HI:i:1 AM:i:70 NM:i:0 SM:i:70 GN:Z:585 T
    N:Z:ENST00000361739 ZN:i:2 PQ:i:6 UQ:i:0 AS:i:0 ZS:Z:R
    HWI-ST1189:59:C1305ACXX:5:1101:10000:12609 163 chr6 74229694 1 51M = 74229740 0 CCCGAATCTACGTGTCCAATGACGA
    CAATGTTGATATGAGTCTTTTCCTTT CCCFFFFFHHHHHIIJJJJIJJJJJJJJIJIIJJJJJJJJHIJJJJJIJJF PG:Z:novoalignMPI NH:i:3 HI:i:1 AM:i:70 NM:i:0 SM:i:70 G
    N:Z:1151 TN:Z:ENST00000309268 ZN:i:3 PQ:i:9 UQ:i:0 AS:i:0 ZS:Z:R
    HWI-ST1189:59:C1305ACXX:5:1101:10000:12609 83 chr6 74229740 1 40M943N11M = 74229694 0 CCTTTCCCATTTTGGCT
    TTTAGGGGTAGTTTTCACGACACCTGTGTTCTGG IJJJJJJJJJJJJJJJJJJJJJJJJJIJJJJJJIJIIHDHHHHFFFFFCCC PG:Z:novoalignMPI NH:i:3 HI:i:1 AM:i:70 NM:i:0 S
    M:i:70 GN:Z:1151 TN:Z:ENST00000309268 ZN:i:3 PQ:i:9 UQ:i:9 AS:i:9 ZS:Z:R XS:A:-

    Thanks in advance!
    Last edited by xuguorong; 10-26-2012, 04:15 PM.

  • #2
    Nobody knows how to run HTSeq with paired-end reads?

    Comment


    • #3
      Umm, well none of those reads uniquely aligned, so I'm not sure what else you would expect. Note the ZS, ZN, and NH flags, as well as the alignment scores.

      Comment


      • #4
        Thank you so much, dpryan!
        I fixed this issue after improving the unique mapping rate!

        Comment

        Latest Articles

        Collapse

        • seqadmin
          Best Practices for Single-Cell Sequencing Analysis
          by seqadmin



          While isolating and preparing single cells for sequencing was historically the bottleneck, recent technological advancements have shifted the challenge to data analysis. This highlights the rapidly evolving nature of single-cell sequencing. The inherent complexity of single-cell analysis has intensified with the surge in data volume and the incorporation of diverse and more complex datasets. This article explores the challenges in analysis, examines common pitfalls, offers...
          06-06-2024, 07:15 AM
        • seqadmin
          Latest Developments in Precision Medicine
          by seqadmin



          Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

          Somatic Genomics
          “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
          05-24-2024, 01:16 PM

        ad_right_rmr

        Collapse

        News

        Collapse

        Topics Statistics Last Post
        Started by seqadmin, 06-14-2024, 07:24 AM
        0 responses
        12 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 06-13-2024, 08:58 AM
        0 responses
        13 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 06-12-2024, 02:20 PM
        0 responses
        17 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 06-07-2024, 06:58 AM
        0 responses
        184 views
        0 likes
        Last Post seqadmin  
        Working...
        X