Header Leaderboard Ad

Collapse

RNASeq paired-end strand specific attribute location in FASTA file

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • RNASeq paired-end strand specific attribute location in FASTA file

    According to TopHat documentation ( for --library-type option) if a strand-specific protocol was used in paired-end sequencing there should be an XS attribute tag assigned to every read. Right - I got my reads in FASTA format - where is my XS tag? If it's not there, where would it normally be? First four reads from raw FASTA file:

    Code:
    @A:3:1101:1441:2249#CTTGCAAC/1 CGCTGGGGCACAGTGACAGGAAACTGAGCAAAACAGCTCGTTGGCACTGATATGCCCCTCCCACCTCCCAGCTCCTGACTCCTATGGGCTGTTGGCTGCC 
    +A:3:1101:1441:2249#CTTGCAAC/1 bbbeeeeegggggfghiiiihhhhghdghhhiiihiiidgghghiihhifggfhcegfhiggggeeeebdddbbcbbbcc]bR]b]acbccbYbc^ 
    @A:3:1101:1593:2030#CTTGCAAC/1 NTGGAAGCAGCAGGTGGAATCCAAGAATATGCCCTTTCAGGATGGCCAAGAATTTGAACTGAGCATCTCAGTGCTGCCAGATAAGTACCAGGTAATGGTC 
    +A:3:1101:1593:2030#CTTGCAAC/1 BP\c`acae^eegdffdeabgfdgddgff^egfghPI^cafhhhhZacfgfhghfghggbe_dghbfdgdgdgabZ^`bbbbbbabbbcbbb_
    Last edited by mknut; 12-06-2012, 06:11 AM. Reason: code tags

  • #2
    I'm assume the edit has messed up the line breaks (it looked OK via my RSS feed).

    Next, you have a FASTQ file there, not a FASTA file.

    Finally, I believe you are asking about using an XS tag which applies to a SAM/BAM file (not in FASTA or FASTQ files).

    Comment


    • #3
      My bad, mixed up the files. Found it now. Thanks

      Comment

      Working...
      X