Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • mknut
    Member
    • Jul 2012
    • 23

    #1

    RNASeq paired-end strand specific attribute location in FASTA file

    According to TopHat documentation ( for --library-type option) if a strand-specific protocol was used in paired-end sequencing there should be an XS attribute tag assigned to every read. Right - I got my reads in FASTA format - where is my XS tag? If it's not there, where would it normally be? First four reads from raw FASTA file:

    Code:
    @A:3:1101:1441:2249#CTTGCAAC/1 CGCTGGGGCACAGTGACAGGAAACTGAGCAAAACAGCTCGTTGGCACTGATATGCCCCTCCCACCTCCCAGCTCCTGACTCCTATGGGCTGTTGGCTGCC 
    +A:3:1101:1441:2249#CTTGCAAC/1 bbbeeeeegggggfghiiiihhhhghdghhhiiihiiidgghghiihhifggfhcegfhiggggeeeebdddbbcbbbcc]bR]b]acbccbYbc^ 
    @A:3:1101:1593:2030#CTTGCAAC/1 NTGGAAGCAGCAGGTGGAATCCAAGAATATGCCCTTTCAGGATGGCCAAGAATTTGAACTGAGCATCTCAGTGCTGCCAGATAAGTACCAGGTAATGGTC 
    +A:3:1101:1593:2030#CTTGCAAC/1 BP\c`acae^eegdffdeabgfdgddgff^egfghPI^cafhhhhZacfgfhghfghggbe_dghbfdgdgdgabZ^`bbbbbbabbbcbbb_
    Last edited by mknut; 12-06-2012, 06:11 AM. Reason: code tags
  • maubp
    Peter (Biopython etc)
    • Jul 2009
    • 1544

    #2
    I'm assume the edit has messed up the line breaks (it looked OK via my RSS feed).

    Next, you have a FASTQ file there, not a FASTA file.

    Finally, I believe you are asking about using an XS tag which applies to a SAM/BAM file (not in FASTA or FASTQ files).

    Comment

    • mknut
      Member
      • Jul 2012
      • 23

      #3
      My bad, mixed up the files. Found it now. Thanks

      Comment

      Latest Articles

      Collapse

      • SEQadmin2
        Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
        by SEQadmin2



        CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

        Despite this, “CRISPR helped turn genome editing from a specialized technique into
        ...
        07-31-2026, 11:01 AM
      • SEQadmin2
        Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
        by SEQadmin2


        Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

        The systematic characterization of the human proteome has
        ...
        07-20-2026, 11:48 AM
      • SEQadmin2
        Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
        by SEQadmin2



        Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
        ...
        07-09-2026, 11:10 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by SEQadmin2, Yesterday, 07:41 AM
      0 responses
      12 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 08-03-2026, 10:13 AM
      0 responses
      25 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-31-2026, 02:55 AM
      0 responses
      38 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-24-2026, 12:17 PM
      0 responses
      25 views
      0 reactions
      Last Post SEQadmin2  
      Working...