Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Extract index reads from raw Fastq file

    We sequenced some 16S rRNA gene amplicons on our collaborator's MiSeq, and got the raw fastq file that looks like the seqs below.
    It seems that there are only reads_1 and reads_2 in the file, and the index reads are missing.
    In addition, the 1:N:0 or 2:N:0 in the header are missing the sample number as seen in the MiSeq fastq files.
    As I need the index reads to feed the data to Qiime for further analysis, I have the following questions:
    1. Is the index-reads info still in this fastq file?
    2. If yes, Is there a way I can extract the index reads?
    3. If no, besides asking our collaborator for the index reads (which I've done but haven't heard from them), is there any other similar program as Qiime but does not require an index read file as the input?
    Thank you for any feedback.
    @MISEQ04:37:000000000-A2G8E:1:1101:14157:1957 1:N:0:TCCACAGGAGT
    TACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTTGTTAAGTTGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCAAAACTGACTGACTAGAGTATGGTAGAGGGTGGTGGAATTTCCTGTGTAGCGGTGAAATGCGTAGATATAGGAAGGAACACCAGTGGCGAAGGCGACCACCTGGACTGATACTGACACTGAGGTGCGAAAGCGTGGGGAGCAAACA
    +
    ?????BB?DDDDDEDDEEEEFFHIHECFFHHHIIIFHHHHIIIEHHHHEHHHAEFEHHEHHEGHHHHHHHHHHHFFFHHHHHHFFEFEFFFFFFFEEEFFFFFFFFFEFFFFFFFFEFFEFFEEFFFFFFFEEFEEFDEEEEEFFFFFFECEEEFEDDED?AACEEEEEDAEEEFEFEFEEEEEEEEEFECEE>?>?8A>;???EEFEEEFFCEE?*1::A:A0CCECA*14)48AEEEE>;;8;88:AC#
    @MISEQ04:37:000000000-A2G8E:1:1101:14157:1957 2:N:0:TCCACAGGAGT
    ACGGACTACCCGGGTTTCTAATCCTGTTTGCTCCCCACGCTTTCGCACCTCAGTGTCAGTATCAGTCCAGGTGGTCGCCTTCGCCACTGGTGTTCCTTCCTATATCTACGCATTTCACCGCTACACAGGAAATTCCACCACCCTCTACCATACTCTAGTCAGTCAGTTTTGAATGCAGTTCCCAGGTTGAGCCCGGGGATTTCACATCCAACTTAACAAACCACCAACCCGCGCTTTACGCCCAGCAATTC
    +
    ?????@@BDDDDDDDDEFFFFFCFFHHHHHHGFHHHHHCDDHHDEDEHHHHHHHFEHFHGGGHHHHHHFCFHHHHF=EEEDCDEHEHHFCFHHEFHFHHFFFFFFFFFFFEEDEEDDDDEE<6@EBCEEFFFFECEEEEECEEE8:CEFFAECECEFAEFE?CEEEECAAAEAEEEFFCEFFFFEE?CEEAEFE'.8?88:?*:AE:CE?*1*:?C*?A?EAEE###########################
    @MISEQ04:37:000000000-A2G8E:1:1101:14713:1991 1:N:0:TCCACAGGAGT
    AACGGAGGGGGCAAGTGTTTCTCGCAATGACTGGGCCTAAAGGGCACGCAGGTGGTTTTCGACAACAGGTATTTCGGTTAAACACTGCAGGCTAACAACAGGTCTGGAATATCTACTAGGAAACTAAGAGTAGTGCTCAGGTCTTTAGAATTGCTAGCGGAGGGGTGGAATCCGGCGAGGCTAGTAGGAATGCTTATGAGTGAAGGCAATTTTCTGGAGCTGACTGACGCTCAGGTGCGCAAGCATGGGGA
    +
    9?????@@DDDDDDDDFFFFFFIEHHHHHHHIIHHIIHHHIHHHIHHEHHHHAEFEHIIIHHHH=FHHHC=DFHFFHEHHFFFFFFFFFDEEEFFFFFFFFFBEEFE=BEEEFFFFEEEEAECEFFFFFFCCEEFFFF?AECAEFFEEEEFFFFFEEEDD8<>DD)8>AEECEA?D?D?D>C?C??:E1?CEEAE?:CAECEAEFFFE8AEEF:?:A:8?*?*:?CAEEEEADCC*0??DD8<?ECEEEE#
    @MISEQ04:37:000000000-A2G8E:1:1101:14713:1991 2:N:0:TCCACAGGAGT
    ACGGACTACTGGGGTATCTAATCCTATTTGATCCCCATGCTTGCGCACCTGAGCGTCAGTCAGCTCCAGAAAATTGCCTTCACTCATAAGCATTCCTACTAGCCTCGCCGGATTCCACCCCTCCGCTAGCAATTCTAAAGACCTGAGCACTACTCTTAGTTTCCTAGTAGATATTCCAGACCTGTTGTTAGCCTGCAGTGTTTAACCGAAATACCTGTTGTCGCAAACCACCTGCGTGCCCTTTAGGCCCA
    +
    AAA?AABBDDDDDD<AFFFGFGHIHFFHHIIHHHHIHIIIIIHHHH@HHIIFHHHHHHHIIHHIIHHGHHFHIIIHHHFCECGHHFHIIHHHHHHHHHHHHHFHDHHHHGGGGGDEEGDEGCGGEEGGGGGGEEGGGEGEEEGCGGCGCEGGGGGGGGGEGGGGEGGEGG?CGGGGGEGGGGGGGGCGEGGCEEGGGGEECEG?C:?828<CCE?EGGGCCCC*.).CC?CEECE8CEC*11CEEE#####
    @MISEQ04:37:000000000-A2G8E:1:1101:13997:2108 1:N:0:TCCACAGGAGT
    TACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTAATTAAACCAGTTGTGAAATCCCCGGGGTCAACCTGGGAATTGCATCTGTGACTGTATAGCTAGAGTACGGTAGAGGGGGATGGGATTCAGCGGGTAGCCGGGAAAAGCGTAGATATGCCGAGGAAACACGGAGGCGAAGGGAATTCTCTGGAACTGGACTTGCGCTCCTGCACGAAAAGCTGGGGAGGAAACA
    +
    ?????BB?BDDDBBBDDDEEFFHIHHHHHHHIHHHIHHHHIHHHEHECEHECEHH<<<,,,,5,,44+4C,@D,CF,,@FF);@))34AAC################################################################################################################################################################
    @MISEQ04:37:000000000-A2G8E:1:1101:13997:2108 2:N:0:TCCACAGGAGT
    ACGGACTACAAGGGTTTCTAATCCTGTTTGCTCCCCACGCTTTCGTGCATGAGCGTCAGTACAGGTCCAGAGGATTGCCTTCGCCATCGGTGTTCCTCCGCATATCTACGCATTTCACTGCTACACGCGGAATTCCATCCCCCTCTACCGTACTCTAGCTATACAGTCACAGATGCAATTCCCAGGTTGAGCCCGGGGATTTCACAACTGTCTTATATAACCGCCTGCGCACGCTTTACGCCCAGCAATTC
    +
    ?????@@BDDDBDD?BEFFFFFFHIIHHHHHIIHHHIC=DDFFGHHFHHIIIHFCCEEHGHIHHH-AEFHDDFFHHHFGGFFHHHHHFHECDEEDHHDFCDEDDFFDFFF@DDED=DEED=,ACFFAEDEDDAEFFFFE?C??8EEEF:8).:AAAEF?CEAECEA?:::CC:?EEEFFE?CCECE*?*:?ADDD84)*1:?EEEECA*00::*::CE:?>'.A?EDD;''')08*AEAD48?######

  • #2
    BTW, another question:
    1. Do the sequences look like they've already been de-multiplexed?
    Also, I am suspecting the index reads are missing b/c I only saw long reads like the ones shown above, but not the shorter ones seen elsewhere.

    Comment


    • #3
      The reads are already de-multiplexed. The tag for the particular sample is appended to the end of the ID line (example below from your data)

      @MISEQ04:37:000000000-A2G8E:1:1101:13997:2108 2:N:0:TCCACAGGAGT

      The two reads (pairs R1--> <--R2) also appear to have been already interlaced.
      Last edited by GenoMax; 02-13-2013, 11:32 AM.

      Comment


      • #4
        I assume you have multiple sample files? Each file should have the sample_ID (somewhere in the file name).

        Comment


        • #5
          Originally posted by GenoMax View Post
          I assume you have multiple sample files? Each file should have the sample_ID (somewhere in the file name).
          Thanks GenoMax. For this raw Fastq file I got the sequences from, it is a pooled sample of multiple indexed-samples.

          Comment


          • #6
            Originally posted by ostrakon View Post
            Thanks GenoMax. For this raw Fastq file I got the sequences from, it is a pooled sample of multiple indexed-samples.
            So hopefully you have the mapping of "tags" <--> "sample_ID" and can split the original file, if needed.

            Comment


            • #7
              Originally posted by GenoMax View Post
              So hopefully you have the mapping of "tags" <--> "sample_ID" and can split the original file, if needed.
              Thank you again, GenoMax. I have the mapping info. I am very glad that the Qiime guys have resolved this issue. They made a python script to parse the raw fastq files, extract the index, and add fake quality scores to make an index read file. I am now happily splitting libraries using the mapping info and the index read file generated this way.

              Here is the reference in case anyone has a similar fastq file as mine:

              https://groups.google.com/forum/?fromgroups=#!topicsearchin/qiime-forum/mariana$20illumina$20sequencing/qiime-forum/TJOtt13jlPs

              Comment

              Latest Articles

              Collapse

              • seqadmin
                The Impact of AI in Genomic Medicine
                by seqadmin



                Artificial intelligence (AI) has evolved from a futuristic vision to a mainstream technology, highlighted by the introduction of tools like OpenAI's ChatGPT and Google's Gemini. In recent years, AI has become increasingly integrated into the field of genomics. This integration has enabled new scientific discoveries while simultaneously raising important ethical questions1. Interviews with two researchers at the center of this intersection provide insightful perspectives into...
                02-26-2024, 02:07 PM
              • seqadmin
                Multiomics Techniques Advancing Disease Research
                by seqadmin


                New and advanced multiomics tools and technologies have opened new avenues of research and markedly enhanced various disciplines such as disease research and precision medicine1. The practice of merging diverse data from various ‘omes increasingly provides a more holistic understanding of biological systems. As Maddison Masaeli, Co-Founder and CEO at Deepcell, aptly noted, “You can't explain biology in its complex form with one modality.”

                A major leap in the field has
                ...
                02-08-2024, 06:33 AM

              ad_right_rmr

              Collapse

              News

              Collapse

              Topics Statistics Last Post
              Started by seqadmin, 02-28-2024, 06:12 AM
              0 responses
              21 views
              0 likes
              Last Post seqadmin  
              Started by seqadmin, 02-23-2024, 04:11 PM
              0 responses
              69 views
              0 likes
              Last Post seqadmin  
              Started by seqadmin, 02-21-2024, 08:52 AM
              0 responses
              77 views
              0 likes
              Last Post seqadmin  
              Started by seqadmin, 02-20-2024, 08:57 AM
              0 responses
              67 views
              0 likes
              Last Post seqadmin  
              Working...
              X