[alexdobin]

I am trying to use STAR to perform simultaneous alignment and gene counting as described in the 2.4.2a manual. I have Illumina TruSeq Total RNA preps sequenced on a HiSeq 4000. I trimmed Illumina adapters and reads with Phred score < 10 using Cutadapt with the arguments below.
Our cluster has a 30 GB RAM limit for jobs, so I first indexed the genome using --genomeSAsparseD 2.

STAR mapping/counting fails with the following error message:
EXITING because of FATAL ERROR in reads input: short read sequence line: 1
Read Name=@K00152:8:H3MF5BBXX:4:1101:30404:1773
Read Sequence====
DEF_readNameLengthMax=50000
DEF_readSeqLengthMax=500

Nov 28 17:54:22 ...... FATAL ERROR, exiting

Hi @rvann,

the error is caused by the zero-length read sequence, STAR cannot process those.
Hopefully, cutadapt has an option to remove them - this has to be done simultaneously from read1 and read2 files to preserve the order of the reads.

Cheers
Alex

[gsgs]

what's the probability that I will be able to get a windows executable that runs on command line per cmd.exe on my computer and also runs from batch files

[rvann]

--quantMode GeneCounts short read error

I am trying to use STAR to perform simultaneous alignment and gene counting as described in the 2.4.2a manual. I have Illumina TruSeq Total RNA preps sequenced on a HiSeq 4000. I trimmed Illumina adapters and reads with Phred score < 10 using Cutadapt with the arguments below.
Our cluster has a 30 GB RAM limit for jobs, so I first indexed the genome using --genomeSAsparseD 2.

STAR mapping/counting fails with the following error message:
EXITING because of FATAL ERROR in reads input: short read sequence line: 1
Read Name=@K00152:8:H3MF5BBXX:4:1101:30404:1773
Read Sequence====
DEF_readNameLengthMax=50000
DEF_readSeqLengthMax=500

Nov 28 17:54:22 ...... FATAL ERROR, exiting

Is it because of the trimming with Cutadapt? Is STAR failing to process 'zero length' reads? Thanks for your help. Log.out file attached

cutadapt 1.8.3:
cutadapt -q 10 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT -o inpath/sample_R1.fastq.gz -p inpath/sample_R2.fastq.gz pathto/sample_R1.fastq.gz pathto/sample_R2.fastq.gz


STAR 2.4.2a:
STAR --genomeLoad NoSharedMemory --genomeSAsparseD 2 --outSAMstrandField intronMotif --genomeDir pathto/STARgenome --sjdbGTFfile pathto/STARgenome/gencode.v23.annotation.gtf --runThreadN 2 --quantMode GeneCounts --readFilesIn pathto/sample_R1.fastq.gz pathto/sample_R2.fastq.gz --readFilesCommand zcat --outFileNamePrefix sample --outSAMtype BAM Unsorted --outStd BAM_Unsorted

[alexdobin]

Hello,

Say I would like to map my data to both human and mouse reference genomes. Can I do both mapping simultaneously with STAR? Can anyone shed a light to me on how this can be effectively done?

Thanks a lot in advance.

Cheers

Hi,

the best way is to generate the genome index for a combined reference of mouse and human. This will require ~60GB of RAM. You would need to make the chromosomes names distinct in the mouse and human genome FASTA (say add m to the mouse chromosome names). You also need to do the same renaming of the chromosome names in the annotations GTFs. The GTFs (say GENCODE) typically have distinct transcript names for different species - if not, you would have to rename them as well. The GTF files from two species have to be concatenated.

Cheers
Alex

[pandamon]

Hello,

Say I would like to map my data to both human and mouse reference genomes. Can I do both mapping simultaneously with STAR? Can anyone shed a light to me on how this can be effectively done?

Thanks a lot in advance.

Cheers

[stu]

Alex -

Worked like a charm! Thank you for your help!

[alexdobin]

Hi @stu,

since you have GFF (not GTF) file, you need to use
--sjdbGTFtagExonParentTranscript Parent
It's actually explained in the manual (chapter 2.2.3)

If this does not work, please post a few "exon" lines of your GFF.

Cheers
Alex

[stu]

I've most recently been submitting jobs with this command:

[scripts]$ sbatch -p Long -N 1 -n 16 --no-requeue STAR_generate_genome_indices.sh

Which I believe should allocate a single node of 16 cores to the job. I've tried this new command:

[scripts]$ sbatch -p Long -N 1 -n 16 --mem 64000 --no-requeue STAR_generate_genome_indices.sh

To see if manually specifying the amount of memory to use makes a difference.

[GenoMax]

I also noticed that you are running STAR with 16 threads. There must be a slurm command to ensure that you are actually getting that many cores and that they are all on the same physical node.

[stu]

I'm pretty sure I'm using 64GB, which is the amount of RAM/node in my cluster. Course, this is an assumption, and we all know what 'assume' does.

[GenoMax]

Looks like you are running this under slurm. How much memory are you allocating to this job?

[stu]

I'm having some difficulty in generating indices with STAR. I'm using a C. elegans WormBase genome and annotations. Every time I attempt to generate indices, I receive the following error, or a variation therin:

SLURM_NODELIST:cnode248
Aug 12 13:54:15 ..... Started STAR run
Aug 12 13:54:15 ... Starting to generate Genome files
Aug 12 13:54:18 ... starting to sort Suffix Array. This may take a long time...
Aug 12 13:54:19 ... sorting Suffix Array chunks and saving them to disk...
Aug 12 13:54:28 ... loading chunks from disk, packing SA...
Aug 12 13:54:31 ... Finished generating suffix array
Aug 12 13:54:31 ... starting to generate Suffix Array index...
Aug 12 13:55:08 ..... Processing annotations GTF
terminate called after throwing an instance of 'std:ut_of_range'
what(): vector::_M_range_check
/tmp/slurmd/job501176/slurm_script: line 5: 14245 Aborted STAR --runThreadN 16 --runMode genomeGenerate --genomeDir ~/CeO2/genomic_ref/ref/ --genomeFastaFiles ~/CeO2/genomic_ref/ref/c_elegans.PRJNA13758.WS240.genomic.fa --sjdbGTFfile ~/CeO2/genomic_ref/ref/c_elegans.PRJNA13758.WS240.annotations.gff

I've made sure that the chromosome names in the FASTA file match the gff. I'm really not sure what else could be wrong.

[GenoMax]

let's see if I can map now

Don't go back to the 64G machine

[profkaramba]

Hi guys

I'm trying to map unmapped human reads to possible contaminants (viruses and bacteria). I download all the complete genomes in ncbi. I have a "concatenated genome" of 9.9Gb in fasta format.

When I try to generate the star index the program stops in

Writing genome to disk... done.
Number of SA indices: 19597668060
SA size in bytes: 85739797763
Jul 29 17:21:10 ... starting to sort  Suffix Array. This may take a long time...
Number of chunks: 43;   chunks size limit: 3994984080 bytes
Jul 29 17:22:26 ... sorting Suffix Array chunks and saving them to disk...
Jul 29 18:59:26 ... loading chunks from disk, packing SA...

no error is reported, it just stops. What can it be?
I tried running it with 6 CPUS and 64Gb of RAM

Ok, problem solved with 200Gb of RAM
Anyway, in the previous run the program didn't report any error. it just stopped working as it had finished... a memory related error should have been given I think!

let's see if I can map now

[profkaramba]

Hi guys

I'm trying to map unmapped human reads to possible contaminants (viruses and bacteria). I download all the complete genomes in ncbi. I have a "concatenated genome" of 9.9Gb in fasta format.

When I try to generate the star index the program stops in

Writing genome to disk... done.
Number of SA indices: 19597668060
SA size in bytes: 85739797763
Jul 29 17:21:10 ... starting to sort  Suffix Array. This may take a long time...
Number of chunks: 43;   chunks size limit: 3994984080 bytes
Jul 29 17:22:26 ... sorting Suffix Array chunks and saving them to disk...
Jul 29 18:59:26 ... loading chunks from disk, packing SA...

no error is reported, it just stops. What can it be?
I tried running it with 6 CPUS and 64Gb of RAM