Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Solexa - same sequence but unique identifier

    Hi all,

    I am seeing this data from a paired end solexa run (pipeline 1.4). The sequence is identical, yet the identifiers (tile# on the flowcell, x and y coordinates) are different. In Bowtie alignment each sequence hits the same start and stop site.

    First, is this PCR bias and second, should all the alignments be kept, none or only 1? Thank you for any comments.

    @HWI-EAS261:6:2:675:1607#0/1
    ATGTGCTCACCTGCCTCATCCATACACATACGTGGCTGCTCTCAC
    +
    ACC=BBAC@CBB@B?;=BAC;?B4;@7BBAA@?;@>A@;=9<3;@
    --
    @HWI-EAS261:6:7:1000:1185#0/1
    ATGTGCTCACCTGCCTCATCCATACACATACGTGGCTGCTCTCAC
    +
    BCCBCCBCBBBCBCACABCABCBBABCBCCBB@B@BBB9B@A@=6
    --
    @HWI-EAS261:6:22:934:1507#0/1
    ATGTGCTCACCTGCCTCATCCATACACATACGTGGCTGCTCTCAC
    +
    BC>ABBCBABCBCCCCC>BBABBCCBCBCCBB@BBB8B@A@@;<;
    --
    @HWI-EAS261:6:24:285:958#0/1
    ATGTGCTCACCTGCCTCATCCATACACATACGTGGCTGCTCTCAC
    +
    BBB7BBA@B@@@?@A?AB@AAB@B@B@A?B@@=?8@=<<7;<<?7
    --
    @HWI-EAS261:6:60:421:1920#0/1
    ATGTGCTCACCTGCCTCATCCATACACATACGTGGCTGCTCTCAC
    +
    BCB?;CBCCBBB;BA@BCBBBAABBBCCBB?B;;<9@:1)5<=@@
    --
    @HWI-EAS261:6:72:284:58#0/1
    ATGTGCTCACCTGCCTCATCCATACACATACGTGGCTGCTCTCAC
    +
    <<A<ACCCCCACCBBCCCBAA<ACBBCBACBB>A<A6@>A@><76

    Layla

  • #2
    Originally posted by Layla View Post
    I am seeing this data from a paired end solexa run (pipeline 1.4). The sequence is identical, yet the identifiers (tile# on the flowcell, x and y coordinates) are different.
    Isn't this the rationale behind massively parallel sequencing? :-)
    Many procedures rely on this: it allows greater confidence in (re)sequencing projects and allows "peaks" in ChIP-seq experiments...

    Comment


    • #3
      Thank you for your quick response dawe
      L

      Comment


      • #4
        Originally posted by Layla View Post
        First, is this PCR bias...?
        To answer that question you would need to calculate (estimate, make a rough guess at) the expected frequency of two independent reads starting at the same base and compare that to the observed frequency. Roughly speaking this relates the size of what is being sequenced to the number of reads collected. If you are sequencing a bacterial genome whose size is 2Mbp and you collect 20 million reads you would expect 10 reads starting at each base (assuming reads are perfectly distributed). If your target DNA size is larger than the number of reads collected than the expectation is that there should be few if any duplicate reads. The size of the "target" will of course depend on what your application is. Genomic sequencing, mRNA-Seq, Chip-Seq, etc.

        I just re-read your post and saw that the data is from a paired-end run. What about the mates for the example reads, are they all the same sequence? If the sequences for two paired reads match for both read1 and read2 then it is almost certain that these reads are PCR duplicates.
        Last edited by kmcarr; 11-23-2009, 10:50 AM. Reason: Add piared-end info.

        Comment


        • #5
          Thank you for your reply kmcarr.

          According to my calculations from medip-seq on the human genome, theoretically I should not have any duplicates

          The mates of these reads have a different sequence

          In the following scenario is it correct to maintain all the reads or should only 1 be kept from 0/1 (same id, start and seq) and all removed from 0/2 (ambiguity due to multiple start sites?)

          HWI-EAS261:6:1:836:220#0/2 - chr4 151950446 GATANGATACGATACGATACGATACGATACGATACGATACGATAC
          HWI-EAS261:6:1:836:220#0/2 - chr4 151950441 GATANGATACGATACGATACGATACGATACGATACGATACGATAC
          HWI-EAS261:6:1:836:220#0/2 - chr4 151950476 GATANGATACGATACGATACGATACGATACGATACGATACGATAC
          HWI-EAS261:6:1:836:220#0/2 - chr4 151950481 GATANGATACGATACGATACGATACGATACGATACGATACGATAC
          HWI-EAS261:6:1:836:220#0/2 - chr4 151950486 GATANGATACGATACGATACGATACGATACGATACGATACGATAC
          HWI-EAS261:6:1:836:220#0/2 - chr4 151950491 GATANGATACGATACGATACGATACGATACGATACGATACGATAC
          HWI-EAS261:6:1:836:220#0/2 - chr4 151950456 GATANGATACGATACGATACGATACGATACGATACGATACGATAC
          HWI-EAS261:6:1:836:220#0/2 - chr4 151950461 GATANGATACGATACGATACGATACGATACGATACGATACGATAC


          HWI-EAS261:6:1:836:220#0/1 + chr4 151950305 AAGTGGCCAGGAATGGTTGTGTGTGCCTGTGGTCCCAGCTAGGTC
          HWI-EAS261:6:1:836:220#0/1 + chr4 151950305 AAGTGGCCAGGAATGGTTGTGTGTGCCTGTGGTCCCAGCTAGGTC
          HWI-EAS261:6:1:836:220#0/1 + chr4 151950305 AAGTGGCCAGGAATGGTTGTGTGTGCCTGTGGTCCCAGCTAGGTC
          HWI-EAS261:6:1:836:220#0/1 + chr4 151950305 AAGTGGCCAGGAATGGTTGTGTGTGCCTGTGGTCCCAGCTAGGTC
          HWI-EAS261:6:1:836:220#0/1 + chr4 151950305 AAGTGGCCAGGAATGGTTGTGTGTGCCTGTGGTCCCAGCTAGGTC
          HWI-EAS261:6:1:836:220#0/1 + chr4 151950305 AAGTGGCCAGGAATGGTTGTGTGTGCCTGTGGTCCCAGCTAGGTC
          HWI-EAS261:6:1:836:220#0/1 + chr4 151950305 AAGTGGCCAGGAATGGTTGTGTGTGCCTGTGGTCCCAGCTAGGTC

          Comment


          • #6
            it seems that your sequence 0/2 is mapping to a simple repeat region. I think you can keep one of them. but it largely due to what your application is.
            Xi Wang

            Comment

            Latest Articles

            Collapse

            • seqadmin
              The Impact of AI in Genomic Medicine
              by seqadmin



              Artificial intelligence (AI) has evolved from a futuristic vision to a mainstream technology, highlighted by the introduction of tools like OpenAI's ChatGPT and Google's Gemini. In recent years, AI has become increasingly integrated into the field of genomics. This integration has enabled new scientific discoveries while simultaneously raising important ethical questions1. Interviews with two researchers at the center of this intersection provide insightful perspectives into...
              02-26-2024, 02:07 PM
            • seqadmin
              Multiomics Techniques Advancing Disease Research
              by seqadmin


              New and advanced multiomics tools and technologies have opened new avenues of research and markedly enhanced various disciplines such as disease research and precision medicine1. The practice of merging diverse data from various ‘omes increasingly provides a more holistic understanding of biological systems. As Maddison Masaeli, Co-Founder and CEO at Deepcell, aptly noted, “You can't explain biology in its complex form with one modality.”

              A major leap in the field has
              ...
              02-08-2024, 06:33 AM

            ad_right_rmr

            Collapse

            News

            Collapse

            Topics Statistics Last Post
            Started by seqadmin, 02-28-2024, 06:12 AM
            0 responses
            27 views
            0 likes
            Last Post seqadmin  
            Started by seqadmin, 02-23-2024, 04:11 PM
            0 responses
            74 views
            0 likes
            Last Post seqadmin  
            Started by seqadmin, 02-21-2024, 08:52 AM
            0 responses
            81 views
            0 likes
            Last Post seqadmin  
            Started by seqadmin, 02-20-2024, 08:57 AM
            0 responses
            69 views
            0 likes
            Last Post seqadmin  
            Working...
            X