how to convert sorted.txt files from the Illumina pipeline v1.3.4 to bam or sam?

[Nino]

@crazyhottommy

Try this script. It gives you the fastq file instead of the sam/bam file

#!/usr/bin/perl -w

use warnings;
use strict;

my $datafile = $ARGV[0];
my $outfile = $ARGV[1];

open (IN, $datafile) or die "can't open the datafile: $datafile\n";
open (OUT, ">$outfile") or die "can't open the outputfile: $outfile\n";

while(my $line=<IN>){
chomp $line;
my @i = split(/\t/, $line);
print OUT "@".$i[0].":".$i[1].$i[2].":".$i[3].":".$i[4].":".$i[5]."#".$i[6]."/".$i[7]."\n".$i[8]."\n"."+"."\n".$i[9]."\n";
}
close IN;
close OUT;

[crazyhottommy]

@crazyhottommy: You should clarify on your blog post that your modifications are specifically targeted for human (?) data. If someone else has a different genome it would be incorrect to follow your procedure, as is.

@Nino/@crazyhottommy: I am not sure what the downstream application is/was in your case but you have to account for the Q-scores probably being in non-sanger format (this is old data). Most new tools will expect them to be in sanger format.

@Nino: Check your PM. I sent you a script to recreate fastq sequence file yesterday. That may be a safer place to start. I can post it here if it works for you.

Thanks, I updated the post accordingly.

[Nino]

@GenoMax: I received your PM if you could please look at my response to see if the file I am working on is an alignment file. Also the data I am working with is from NCBI website which I downloaded to use, apparently they (people who uploaded the data) used the CASAVA Illumina pipeline (this is all the information that was given to me).

[GenoMax]

@crazyhottommy: You should clarify on your blog post that your modifications are specifically targeted for human (?) data. If someone else has a different genome it would be incorrect to follow your procedure, as is.

@Nino/@crazyhottommy: I am not sure what the downstream application is/was in your case but you have to account for the Q-scores probably being in non-sanger format (this is old data). Most new tools will expect them to be in sanger format.

@Nino: Check your PM. I sent you a script to recreate fastq sequence file yesterday. That may be a safer place to start. I can post it here if it works for you.

[crazyhottommy]

Hey were you ever able to find a solution to your problem? I am currently running into the same issue as well.

[jhpce01 /amber3/feinbergLab/personal/sramazan/chip-seq]$ /amber3/feinbergLab/personal/sramazan/perl/scripts/export2sam.pl --read1=GSM1053091_mm9.nac.inp1.sorted.txt
@PG ID:export2sam.pl VN:2.3.1 CL:/amber3/feinbergLab/personal/sramazan/perl/scripts/export2sam.pl --read1=GSM1053091_mm9.nac.inp1.sorted.txt

ERROR: Unexpected number of fields in export record on line 1 of read1 export file. Found 16 fields but expected 22.
...erroneous export record:
HWI-EASXXX 1 2 35 1301 1347 0 1 ATGTAGCTAGAGACTTGAGCTCTGGGGGGTACTGGT aaa^]`aa`a_a_[_^`^`__`^^^][_XLQR[[]S chr10.fa 3003189 F 36 12

see my post here http://crazyhottommy.blogspot.com/20...-bam-file.html

[Nino]

Hey were you ever able to find a solution to your problem? I am currently running into the same issue as well.

[jhpce01 /amber3/feinbergLab/personal/sramazan/chip-seq]$ /amber3/feinbergLab/personal/sramazan/perl/scripts/export2sam.pl --read1=GSM1053091_mm9.nac.inp1.sorted.txt
@PG ID:export2sam.pl VN:2.3.1 CL:/amber3/feinbergLab/personal/sramazan/perl/scripts/export2sam.pl --read1=GSM1053091_mm9.nac.inp1.sorted.txt

ERROR: Unexpected number of fields in export record on line 1 of read1 export file. Found 16 fields but expected 22.
...erroneous export record:
HWI-EASXXX 1 2 35 1301 1347 0 1 ATGTAGCTAGAGACTTGAGCTCTGGGGGGTACTGGT aaa^]`aa`a_a_[_^`^`__`^^^][_XLQR[[]S chr10.fa 3003189 F 36 12

[crazyhottommy]

Hi all,

I found http://genomewiki.ucsc.edu/index.php/ABRF2010_Tutorial

I downloaded the latest version of samtools

I use export2sam.pl --read1=chr21_export.txt \
| perl -wpe 's/(chr.*)\.fa/$1/' \
> chr21.sam

it says

ERROR: Unexpected number of fields in export record on line 1 of read1 export file. Found 16 fields but expected 22.

my sorted.txt file only contains 16 fields, and the program is complaining about that.

but the example file given in the link above also contains only 16 fields.
I though may be they changed the format. so I then downloaded the earlier version of samtools (0.1.8,0.1.9 etc...)

still, it gave me error like:

Use of uninitialized value $t[21] in string eq at export2sam.pl line 279,


earlier version just says die at liine 17.

Can anyone help me? Thanks!

[crazyhottommy]

Hi all,

how to convert the sorted.txt file from illumina pipeline to bam or sam file?

Thanks.