Hi all,
I having sequence .fastq that I need to convert to fasta and qual formats.
I tried using this converter
but I keep getting some error message saying that the captions are not right and:
Error during conversion: Invalid character in quality string
This is a sample of the sequences (letters and numbers at the beginning of the sequence are altered) I have, obtained by solexa
@XXX004460.1_BI:080722_SL-XBE_0007_FC3061LAAXX:6:1:1319:692_length=51
ACGATGTGACGTACGCGTATGCTCGTATACACACGCATGACGAGCGACGAT
+XXX004460.1_BI:080722_SL-XBE_0007_FC3061LAAXX:6:1:1319:692_length=51
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII@I
Any idea how I can convert them to fasta and qual?
I having sequence .fastq that I need to convert to fasta and qual formats.
I tried using this converter
but I keep getting some error message saying that the captions are not right and:
Error during conversion: Invalid character in quality string
This is a sample of the sequences (letters and numbers at the beginning of the sequence are altered) I have, obtained by solexa
@XXX004460.1_BI:080722_SL-XBE_0007_FC3061LAAXX:6:1:1319:692_length=51
ACGATGTGACGTACGCGTATGCTCGTATACACACGCATGACGAGCGACGAT
+XXX004460.1_BI:080722_SL-XBE_0007_FC3061LAAXX:6:1:1319:692_length=51
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII@I
Any idea how I can convert them to fasta and qual?
Comment