Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • tophat marking "read in a proper pair" wrongly

    Hi
    I have a paired end reads below mapping to genome perfectly, but tophat (ver 2.0.4) mark "not mapped in proper pair". flag = 161 and 81. can anyone explain it?

    FCC0336ACXX:8:2202:8102:65253#TCTTGGTC 161 chr19 18286416 50 90M = 18287979 1653 CCTGCGTGTTGGATGAACTTGACATGGAGCTAGCCTTCCTGACCATTGTCTGCATGGAAGAGTTTGAGGACATGGAGAGAAGTCTGCCAC bbbeeeeegggggiiiiiiihiiiiiihiiiiiihiiiiiighiiiihhihghhiiihiiiibffhiiigggggeeecccdddcdccccc AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:90 YT:Z:UU NH:i:1 XS:A:+
    FCC0336ACXX:8:2202:8102:65253#TCTTGGTC 81 chr19 18287979 50 90M = 18286416 -1653 GCCAGACACTATCATGGAGTGTGCAATGGGGGACCGCGGCATGCAGCTCATGCACGCCAACGCCCAGCGGACAGATGCTCTCCAGCCACA _bbbcbb``dbbbbbbbba_b_b`bbaaaaaa^abddgehhhhhhfffgge`_^`ae_f_e\hf]aeaged_fdfe_b^c]gccccc___ AS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:89C0 YT:Z:UU NH:i:1 XS:A:+

  • #2
    Did you provide a reference annotation? If not, the ~1.6kb apparent fragment length will make cause that (presumably it's spliced and tophat was just unaware of that).

    Comment


    • #3
      thanks. I got it.
      if bam file is sorted, using picard API, searching by chromosome coordinate is very quick. what picard API should I use to search by read name (for example, FCC0336ACXX:8:2202:8102:65253#TCTTGGTC in the previous email)?
      my bam is now is queryname sorted.

      Comment


      • #4
        Originally posted by jay2008 View Post
        thanks. I got it.
        if bam file is sorted, using picard API, searching by chromosome coordinate is very quick. what picard API should I use to search by read name (for example, FCC0336ACXX:8:2202:8102:65253#TCTTGGTC in the previous email)?
        my bam is now is queryname sorted.
        I'm don't use the Picard Java API, but rather the samtools C API, so I'm likely not the best person to answer that. I know with the samtools C API, there's no equivalent to the coordinate search, since the BAM indexing that's used only applies to coordinate sorted files. In reality, I suspect one could just write a new indexing/searching function for name-sorted files. Perhaps the Picard API provides this functionality.

        Comment

        Latest Articles

        Collapse

        • seqadmin
          Best Practices for Single-Cell Sequencing Analysis
          by seqadmin



          While isolating and preparing single cells for sequencing was historically the bottleneck, recent technological advancements have shifted the challenge to data analysis. This highlights the rapidly evolving nature of single-cell sequencing. The inherent complexity of single-cell analysis has intensified with the surge in data volume and the incorporation of diverse and more complex datasets. This article explores the challenges in analysis, examines common pitfalls, offers...
          06-06-2024, 07:15 AM
        • seqadmin
          Latest Developments in Precision Medicine
          by seqadmin



          Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

          Somatic Genomics
          “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
          05-24-2024, 01:16 PM

        ad_right_rmr

        Collapse

        News

        Collapse

        Topics Statistics Last Post
        Started by seqadmin, Yesterday, 07:24 AM
        0 responses
        10 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 06-13-2024, 08:58 AM
        0 responses
        11 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 06-12-2024, 02:20 PM
        0 responses
        16 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 06-07-2024, 06:58 AM
        0 responses
        184 views
        0 likes
        Last Post seqadmin  
        Working...
        X