tophat marking "read in a proper pair" wrongly

[jay2008]

Hi
I have a paired end reads below mapping to genome perfectly, but tophat (ver 2.0.4) mark "not mapped in proper pair". flag = 161 and 81. can anyone explain it?

FCC0336ACXX:8:2202:8102:65253#TCTTGGTC 161 chr19 18286416 50 90M = 18287979 1653 CCTGCGTGTTGGATGAACTTGACATGGAGCTAGCCTTCCTGACCATTGTCTGCATGGAAGAGTTTGAGGACATGGAGAGAAGTCTGCCAC bbbeeeeegggggiiiiiiihiiiiiihiiiiiihiiiiiighiiiihhihghhiiihiiiibffhiiigggggeeecccdddcdccccc AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:90 YT:Z:UU NH:i:1 XS:A:+
FCC0336ACXX:8:2202:8102:65253#TCTTGGTC 81 chr19 18287979 50 90M = 18286416 -1653 GCCAGACACTATCATGGAGTGTGCAATGGGGGACCGCGGCATGCAGCTCATGCACGCCAACGCCCAGCGGACAGATGCTCTCCAGCCACA _bbbcbb``dbbbbbbbba_b_b`bbaaaaaa^abddgehhhhhhfffgge`_^`ae_f_e\hf]aeaged_fdfe_b^c]gccccc___ AS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:89C0 YT:Z:UU NH:i:1 XS:A:+

[dpryan]

Did you provide a reference annotation? If not, the ~1.6kb apparent fragment length will make cause that (presumably it's spliced and tophat was just unaware of that).

[jay2008]

thanks. I got it.
if bam file is sorted, using picard API, searching by chromosome coordinate is very quick. what picard API should I use to search by read name (for example, FCC0336ACXX:8:2202:8102:65253#TCTTGGTC in the previous email)?
my bam is now is queryname sorted.

[dpryan]

thanks. I got it.
if bam file is sorted, using picard API, searching by chromosome coordinate is very quick. what picard API should I use to search by read name (for example, FCC0336ACXX:8:2202:8102:65253#TCTTGGTC in the previous email)?
my bam is now is queryname sorted.

I'm don't use the Picard Java API, but rather the samtools C API, so I'm likely not the best person to answer that. I know with the samtools C API, there's no equivalent to the coordinate search, since the BAM indexing that's used only applies to coordinate sorted files. In reality, I suspect one could just write a new indexing/searching function for name-sorted files. Perhaps the Picard API provides this functionality.