Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • blancha
    replied
    How about samtools view to select the region of interest, and then bamtools bedtobam to convert the BAM file to the BED format?

    You can pipe the output of samtools view directly to bedtobam.
    Last edited by blancha; 11-14-2015, 06:33 PM.

    Leave a comment:


  • seqprone
    replied
    Is there a way I could extract a range, say [chr3,a,b] to a BED format from a BAM file?

    Leave a comment:


  • dpryan
    replied
    Have a read through the SAM specification.

    Leave a comment:


  • mslider
    replied
    okay i understand,
    and is there a way to calculate the length of splicing region ?

    Leave a comment:


  • dpryan
    replied
    The second value would be the end of where the read aligns.

    Leave a comment:


  • mslider
    replied
    yes but what's mean the second coordinate 8213 ?

    Leave a comment:


  • dpryan
    replied
    The read is spliced (note 7841N in the CIGAR string), so bamToBed is correct.

    Leave a comment:


  • mslider
    replied
    --Hi,

    i have a strange result using BamToBed and awk command line:

    samtools view -F 0x0004 464_J3_D1.bam | head -1
    IP6FNQC01CAO42 0 gi|2281652|gb|AF004394.1| 18 40 5S304M7841N12M1D38M3S * 0 0 TTAACTCCCAGAAAAGACAAGATATCCTTGATCTGTGGGTCTACCACACGCAAGGCTACTTCCCTGATTGGCAGAACTACACACCAGGGCCAGGGATCAGATATCCACTGACCTTTGGATGGTGCTTCAAGCTAGTACCAGTGGAGCCAGAGAAGGTAGAAGAGGCCAATGAAGGAGAGAACAACAGCCTGTTACACCCTATGAGCCTGCATGGGATGGAGGACCCGGAGAAGGAAGTGTTAATGTGGCGGTTTGACAGCAGCCTAGCATTTCATCACATGGCCCGAGAGCTGCATCCGGAGCACTACAAGAACCAACAAGAAAGAATGAACAAGAATTATTAGAATTGGATAAATGGGACA 433146444?8.//153FFFFFFIIIIGGIIIIIII:::=IIIGGIIIIIIIIIIIIIIIIIIIHIIIIIIIIIIGIIIIIIIGGG888GGI666GIIIIIIIIIIIIIGFEEGGIIIII===GGGGGGGGGGGGGGGGGGGGGGGGGGGGG@@@@GGGDDE@>>AACCGDDDDDDDDE<<<>DCDFIIIIEDFFDDDDFDDFFDDDFFECC221;C>>>B?>888EGC>>>@CGGGC>>>BBBBB>>>::333<>;;;>>BBBGDDDDCCCDDDDDCCBAAAABCDBBBBBBAAA4444@@BB?==A???A?<<444;40..../588633579<<../0009<<<<<::=988:////25 MD:Z:17G17T8A45G46T9C2A14A14T21A6A5T3A6GA8GCA4AA10C41T13G4^A27A5G4 NH:i:1 HI:i:1 NM:i:26 SM:i:40 XQ:i:40 X2:i:0 XS:A:?

    bamToBed give me this result:
    gi|2281652|gb|AF004394.1| 17 8213 IP6FNQC01CAO42 40 +

    and
    awk '{OFS="\t"; if (and($2, 16)) print $3,$4,$4+length($10),$1,$5,"-"; else print $3,$4,$4+length($10),$1,$5,"+" }'

    give me:
    gi|2281652|gb|AF004394.1| 18 380 IP6FNQC01CAO42 40 +


    in bamToBed result i have 8213, why ?

    thank you --

    Leave a comment:


  • freeseek
    replied
    bedtools bamtobed when large indels are present

    I really like the bedtools bamtobed command, although there are some instances where reads skip very large indels and you don't want the bed file to include those indels. The only information you need is contained in columns 3 (chromosome), 4 (base pair start), and 6 (CIGAR) of the BAM file. Here is a simple awk script that should work (it really should be an option of bedtools bamtobed):
    Code:
    samtools view in.bam |
      awk '{split ($6,a,"[MIDNSHP]"); bp=$4-1; n=0;
        for (i=1; i<=length(a); i++) {
          n+=1+length(a[i]);
          if (substr($6,n,1)=="M") print $3"\t"bp"\t"(bp+=a[i]);
          if (substr($6,n,1)=="D") bp+=a[i];
        }
      }' > out.bed

    Leave a comment:


  • quinlana
    replied
    Here is the sample code from Heng Li.

    Download SAM tools for free. SAM (Sequence Alignment/Map) is a flexible generic format for storing nucleotide sequence alignment. SAMtools provide efficient utilities on manipulating alignments in the SAM format.

    Protocol #4 describes his cut at bamToBed.

    Aaron

    Leave a comment:


  • dawe
    replied
    Hi,

    Originally posted by zhenshao View Post
    Dear all,

    I downloaded a file in .BAM format and want to transform it into .BED format. What can I do? Thanks a lot!

    Zhen
    I'm happy that BEDTools now include a bam->bed conversion utility... btw you still may try this (at least for Illumina reads):

    Code:
    samtools view -F 0x0004 $filein | awk '{OFS="\t"; if (and($2, 16)) print $3,$4,$4+length($10),$1,$5,"-"; else print $3,$4,$4+length($10),$1,$5,"+" }
    d

    Leave a comment:


  • quinlana
    replied
    Hi,
    I just finished a new version of BEDTools which has a C++ utility call bamToBed. This tool will convert BAM alignments to BED or BEDPE (see the BEDTools documentation) format. For example:

    1. Convert BAM alignments to BED format.
    Code:
    $ bamToBed -i reads.bam > reads.bed
    2. Convert BAM alignments to BED format using edit distance (NM) as the BED “score”. Default is mapping quality.
    Code:
    $ bamToBed -i reads.bam -ed > reads.bed
    3. Convert BAM alignments to BEDPE format.
    Code:
    $ bamToBed -i reads.bam -bedpe > reads.bedpe
    Heng Li also posted a nice example of how to create a BAMToBED utility using the SamTools code base.


    You might also be interested in two other utilities in BEDTools that now support BAM input and output. Namely, intersectBed now accepts BAM files as input and will separately compare each alignment (each end separately if paired-end) to a BED file. One can create a new BAM file based on those alignments that do or do not overlap the BED features in question. Similarly, pairToBed does the same thing, but requires that the BAM file be paired. This tools is a bit more sophisticated in that one can require the "span" of the aligned pair to overlap, as well as either/both/neither/xor/notboth ends of the pair.

    For example:

    1. Retain only paired-end BAM alignments where neither end overlaps simple sequence repeats.
    Code:
    $ pairToBed -abam reads.bam -b SSRs.bed -type neither > reads.noSSRs.bam
    2. Retain only paired-end BAM alignments where both ends overlap segmental duplications.
    Code:
    $ pairToBed -abam reads.bam -b segdups.bed -type both > reads.SSRs.bam
    3. Retain only paired-end BAM alignments where neither or one and only one end overlaps segmental duplications.
    Code:
    $ pairToBed -abam reads.bam -b segdups.bed -type notboth > reads.notbothSSRs.bam

    The BAM support is built upon Derek Barnett's nice C++ BAM API called BAMTools (http://sourceforge.net/projects/bamtools/). I'd encourage you to take a look at the new BEDTools manual for more details if you are interested.

    Best,
    Aaron

    Leave a comment:


  • zhenshao
    started a topic How to transform BAM format to .TXT or .BED?

    How to transform BAM format to .TXT or .BED?

    Dear all,

    I downloaded a file in .BAM format and want to transform it into .BED format. What can I do? Thanks a lot!

    Zhen

Latest Articles

Collapse

  • seqadmin
    Current Approaches to Protein Sequencing
    by seqadmin


    Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
    04-04-2024, 04:25 PM
  • seqadmin
    Strategies for Sequencing Challenging Samples
    by seqadmin


    Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...
    03-22-2024, 06:39 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 04-11-2024, 12:08 PM
0 responses
18 views
0 likes
Last Post seqadmin  
Started by seqadmin, 04-10-2024, 10:19 PM
0 responses
22 views
0 likes
Last Post seqadmin  
Started by seqadmin, 04-10-2024, 09:21 AM
0 responses
16 views
0 likes
Last Post seqadmin  
Started by seqadmin, 04-04-2024, 09:00 AM
0 responses
47 views
0 likes
Last Post seqadmin  
Working...
X