Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Allpath-LG assembled contig fasta file contain "B"

    I us Allpath-LG to assembly a genome and I got "B" letter in fasta file as be low


    TTAAACTTGAAATACCCTATCATCCAGGCCCCTATGGCGGGGGTCACGACTATTGAAATGGCCGCTAAGGCTTGTATTGC
    GGGBGCCATAGCTTCACTACCCCTATCCCACTTAGACTTCAGAAAGGTCAATGATATTGAAAAGCTTAAACTGATGGTTT
    CACAATTCAGAGATCAAGTAGCCGATGAATCTTTAGAGGGCAATCTCAACCTAAACTTTTTTTGCCATRATATCGTTGAT

    What happen ?

  • #2
    Assuming Allpath-LG supports this, it could be an IUPAC ambiguity code meaning C or G or T.

    Or, it could simply be an error - that kind of thing can happen with faulty RAM for example. Try running memtest on your machine?

    Comment


    • #3
      Originally posted by intawat View Post
      I us Allpath-LG to assembly a genome and I got "B" letter in fasta file as be low


      TTAAACTTGAAATACCCTATCATCCAGGCCCCTATGGCGGGGGTCACGACTATTGAAATGGCCGCTAAGGCTTGTATTGC
      GGGBGCCATAGCTTCACTACCCCTATCCCACTTAGACTTCAGAAAGGTCAATGATATTGAAAAGCTTAAACTGATGGTTT
      CACAATTCAGAGATCAAGTAGCCGATGAATCTTTAGAGGGCAATCTCAACCTAAACTTTTTTTGCCATRATATCGTTGAT

      What happen ?
      grep -c "B" <file with contigs>

      Is the output more than 1?

      Comment


      • #4
        I have encountered this too. I have 46 Bs in my assembly and several other IUPAC ambiguity code symbols (e.g. S, V, H), which appear to be more common in my Allpaths-LG assembly compared to other assemblers' output.

        Does anyone know if there are options to change the base calling in Allpaths? Or at the very least, what algorithm the program is using to decide an ambiguous base? I think the program is being too conservative.

        Comment

        Latest Articles

        Collapse

        • seqadmin
          Essential Discoveries and Tools in Epitranscriptomics
          by seqadmin




          The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...
          04-22-2024, 07:01 AM
        • seqadmin
          Current Approaches to Protein Sequencing
          by seqadmin


          Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
          04-04-2024, 04:25 PM

        ad_right_rmr

        Collapse

        News

        Collapse

        Topics Statistics Last Post
        Started by seqadmin, Yesterday, 08:47 AM
        0 responses
        14 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 04-11-2024, 12:08 PM
        0 responses
        60 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 04-10-2024, 10:19 PM
        0 responses
        60 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 04-10-2024, 09:21 AM
        0 responses
        54 views
        0 likes
        Last Post seqadmin  
        Working...
        X