I have encountered this too. I have 46 Bs in my assembly and several other IUPAC ambiguity code symbols (e.g. S, V, H), which appear to be more common in my Allpaths-LG assembly compared to other assemblers' output.
Does anyone know if there are options to change the base calling in Allpaths? Or at the very least, what algorithm the program is using to decide an ambiguous base? I think the program is being too conservative.
-
grep -c "B" <file with contigs>Originally posted by intawat View PostI us Allpath-LG to assembly a genome and I got "B" letter in fasta file as be low
TTAAACTTGAAATACCCTATCATCCAGGCCCCTATGGCGGGGGTCACGACTATTGAAATGGCCGCTAAGGCTTGTATTGC
GGGBGCCATAGCTTCACTACCCCTATCCCACTTAGACTTCAGAAAGGTCAATGATATTGAAAAGCTTAAACTGATGGTTT
CACAATTCAGAGATCAAGTAGCCGATGAATCTTTAGAGGGCAATCTCAACCTAAACTTTTTTTGCCATRATATCGTTGAT
What happen ?
Is the output more than 1?Leave a comment:
-
Assuming Allpath-LG supports this, it could be an IUPAC ambiguity code meaning C or G or T.
Or, it could simply be an error - that kind of thing can happen with faulty RAM for example. Try running memtest on your machine?Leave a comment:
-
Allpath-LG assembled contig fasta file contain "B"
I us Allpath-LG to assembly a genome and I got "B" letter in fasta file as be low
TTAAACTTGAAATACCCTATCATCCAGGCCCCTATGGCGGGGGTCACGACTATTGAAATGGCCGCTAAGGCTTGTATTGC
GGGBGCCATAGCTTCACTACCCCTATCCCACTTAGACTTCAGAAAGGTCAATGATATTGAAAAGCTTAAACTGATGGTTT
CACAATTCAGAGATCAAGTAGCCGATGAATCTTTAGAGGGCAATCTCAACCTAAACTTTTTTTGCCATRATATCGTTGAT
What happen ?
-
The first FDA-approved CRISPR-based therapy marked the transition of therapeutic gene editing from a dream to reality1. CRISPR technologies have streamlined gene editing, and CRISPR screens have become an important approach for identifying genes involved in disease processes2. This technique introduces targeted mutations across numerous genes, enabling large-scale identification of gene functions, interactions, and pathways3. Identifying the full range...08-27-2024, 04:44 AM -
Sequencing mRNA provides a snapshot of cellular activity, allowing researchers to study the dynamics of cellular processes, compare gene expression across different tissue types, and gain insights into the mechanisms of complex diseases. “mRNA’s central role in the dogma of molecular biology makes it a logical and relevant focus for transcriptomic studies,” stated Sebastian Aguilar Pierlé, Ph.D., Application Development Lead at Inorevia. “One of the major hurdles for...08-07-2024, 12:11 PM
Leave a comment: