I have encountered this too. I have 46 Bs in my assembly and several other IUPAC ambiguity code symbols (e.g. S, V, H), which appear to be more common in my Allpaths-LG assembly compared to other assemblers' output.
Does anyone know if there are options to change the base calling in Allpaths? Or at the very least, what algorithm the program is using to decide an ambiguous base? I think the program is being too conservative.
-
grep -c "B" <file with contigs>Originally posted by intawat View PostI us Allpath-LG to assembly a genome and I got "B" letter in fasta file as be low
TTAAACTTGAAATACCCTATCATCCAGGCCCCTATGGCGGGGGTCACGACTATTGAAATGGCCGCTAAGGCTTGTATTGC
GGGBGCCATAGCTTCACTACCCCTATCCCACTTAGACTTCAGAAAGGTCAATGATATTGAAAAGCTTAAACTGATGGTTT
CACAATTCAGAGATCAAGTAGCCGATGAATCTTTAGAGGGCAATCTCAACCTAAACTTTTTTTGCCATRATATCGTTGAT
What happen ?
Is the output more than 1?Leave a comment:
-
Assuming Allpath-LG supports this, it could be an IUPAC ambiguity code meaning C or G or T.
Or, it could simply be an error - that kind of thing can happen with faulty RAM for example. Try running memtest on your machine?Leave a comment:
-
Allpath-LG assembled contig fasta file contain "B"
I us Allpath-LG to assembly a genome and I got "B" letter in fasta file as be low
TTAAACTTGAAATACCCTATCATCCAGGCCCCTATGGCGGGGGTCACGACTATTGAAATGGCCGCTAAGGCTTGTATTGC
GGGBGCCATAGCTTCACTACCCCTATCCCACTTAGACTTCAGAAAGGTCAATGATATTGAAAAGCTTAAACTGATGGTTT
CACAATTCAGAGATCAAGTAGCCGATGAATCTTTAGAGGGCAATCTCAACCTAAACTTTTTTTGCCATRATATCGTTGAT
What happen ?
-
Tumors contain complex mixtures of cell populations that evolve in response to treatment and host-specific factors. Tissue biopsies provide only static snapshots of a tumor’s state. But what if we could follow that evolution over time using a minimally invasive technique?
Liquid biopsies can detect tumor-derived material circulating in the bloodstream, providing a way to study treatment response, detect emerging resistance, and discover new biomarkers. Circulating...10-14-2026, 09:55 AM -
Researchers using sequencing and genomics tools often have to make trade-offs. They can choose between speed or scale, short reads or long-range information, or targeted panels or a view of the whole transcriptome. New technologies that have been released this year are built to address those tough choices.
We asked six companies the same four questions to learn about their latest products. The new technologies bring a lot to the table, including rethinking sequencing...
Leave a comment: