Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • acgt
    replied
    I have encountered this too. I have 46 Bs in my assembly and several other IUPAC ambiguity code symbols (e.g. S, V, H), which appear to be more common in my Allpaths-LG assembly compared to other assemblers' output.

    Does anyone know if there are options to change the base calling in Allpaths? Or at the very least, what algorithm the program is using to decide an ambiguous base? I think the program is being too conservative.

    Leave a comment:


  • AdrianP
    replied
    Originally posted by intawat View Post
    I us Allpath-LG to assembly a genome and I got "B" letter in fasta file as be low


    TTAAACTTGAAATACCCTATCATCCAGGCCCCTATGGCGGGGGTCACGACTATTGAAATGGCCGCTAAGGCTTGTATTGC
    GGGBGCCATAGCTTCACTACCCCTATCCCACTTAGACTTCAGAAAGGTCAATGATATTGAAAAGCTTAAACTGATGGTTT
    CACAATTCAGAGATCAAGTAGCCGATGAATCTTTAGAGGGCAATCTCAACCTAAACTTTTTTTGCCATRATATCGTTGAT

    What happen ?
    grep -c "B" <file with contigs>

    Is the output more than 1?

    Leave a comment:


  • maubp
    replied
    Assuming Allpath-LG supports this, it could be an IUPAC ambiguity code meaning C or G or T.

    Or, it could simply be an error - that kind of thing can happen with faulty RAM for example. Try running memtest on your machine?

    Leave a comment:


  • intawat
    started a topic Allpath-LG assembled contig fasta file contain "B"

    Allpath-LG assembled contig fasta file contain "B"

    I us Allpath-LG to assembly a genome and I got "B" letter in fasta file as be low


    TTAAACTTGAAATACCCTATCATCCAGGCCCCTATGGCGGGGGTCACGACTATTGAAATGGCCGCTAAGGCTTGTATTGC
    GGGBGCCATAGCTTCACTACCCCTATCCCACTTAGACTTCAGAAAGGTCAATGATATTGAAAAGCTTAAACTGATGGTTT
    CACAATTCAGAGATCAAGTAGCCGATGAATCTTTAGAGGGCAATCTCAACCTAAACTTTTTTTGCCATRATATCGTTGAT

    What happen ?

Latest Articles

Collapse

  • seqadmin
    Essential Discoveries and Tools in Epitranscriptomics
    by seqadmin




    The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...
    04-22-2024, 07:01 AM
  • seqadmin
    Current Approaches to Protein Sequencing
    by seqadmin


    Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
    04-04-2024, 04:25 PM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, Yesterday, 08:47 AM
0 responses
14 views
0 likes
Last Post seqadmin  
Started by seqadmin, 04-11-2024, 12:08 PM
0 responses
60 views
0 likes
Last Post seqadmin  
Started by seqadmin, 04-10-2024, 10:19 PM
0 responses
60 views
0 likes
Last Post seqadmin  
Started by seqadmin, 04-10-2024, 09:21 AM
0 responses
54 views
0 likes
Last Post seqadmin  
Working...
X