Header Leaderboard Ad

Collapse

Tophat2 produces thousands of invalid alignments

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Tophat2 produces thousands of invalid alignments

    Users beware. Tophat2 produces thousands of CIGAR alignments that are just plain wrong. As an example, see the following .bam file line:

    M01478:14:000000000-A5C8R:1:1106:17706:4022 256 CYDV_S1_L001_R1_trimmed_(paired)_contigs_50/104 4239 3 1M184N110M * CTGCTCTGCCCTATGCGATCTGTCCGATCGATCCTTCCAGACCATTGTGGAGGACGAAGATGTTGTTGATACCCCGAACGGACCGTGGCTCCCTGTGCAGGATGATGGTGT DEEEEFFFFFCFGGGGGGGGGGHHHGGGGGGHHGHHHHHHHGHHHHHHHGHHGGHGGGGGHHHHHHHHHHHHHHHGGGGGGGGGGGHGGHHGGHHHHHHHHGHHHHHHGHG AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:111 YT:Z:UU XS:A:- NH:i:2 CC:Z:= CP:i:4423 HI:i:0

    The CIGAR indicates a single match/mismatch, then 184 nucleotides that are missing from the read relative to the reference and then 110 match/mismatches. Obviously, this has to be wrong. There is no way you can predict that a single nucleotide matches a position 184 nucleotides upstream of the rest of an alignment, when there are about 40 intervening base positions that are equally valid matches. Furthermore, in this particular example, there is no mismatch. The first nucleotide precisely matches the nucleotide upstream of the 110 aligned nucleotides. In other words, Tophat is just "making stuff up"! Note: no paired end reads were used in this Tophat run.

  • #2
    To be fair, did you give tophat a reference GTF/GFF to use? If so, you're asking it to align against the transcriptome first and then convert those coordinates back to the genome. You're rather likely to get results like this by doing that (yes, it's probably better to simply soft-clip that one base, but you didn't use local-alignment and, anyway, it then matched the transcriptome).

    Comment


    • #3
      Tophat2 is stupid

      Originally posted by dpryan View Post
      To be fair, did you give tophat a reference GTF/GFF to use? If so, you're asking it to align against the transcriptome first and then convert those coordinates back to the genome. You're rather likely to get results like this by doing that (yes, it's probably better to simply soft-clip that one base, but you didn't use local-alignment and, anyway, it then matched the transcriptome).
      Nope, no reference provided. These were reads mapped to a viral genome. When I imported the .bam file into IGV, it showed a fraction of reads that were predicted to be spliced. When I followed up on these, they turned out to be bogus because all of the reads contained a single nucleotide on one side of the predicted splice site. It turns out that Tophat2 looks for putative intron splice sites and automatically assumes that the introns are valid as long as it can align at least ONE nucleotide on the other side of the splice junction. How stupid is that?

      Comment


      • #4
        Ah, well then those are really junk then. Predicting splicing based on a single base without a reference annotation seems like a bad idea! Thanks for the heads-up and you might consider making a bug report for tophat.

        Comment


        • #5
          Using tophat for a viral genome seems a little odd -- I wasn't aware that viruses had introns.

          Comment


          • #6
            Originally posted by gringer View Post
            Using tophat for a viral genome seems a little odd -- I wasn't aware that viruses had introns.
            Viruses undergo RNA recombination which produces molecules that are identical in structure to spliced transcripts. The only difference is that the border sequences don't match consensus splice junctions. Therefore, I was looking for reads that mapped to different regions of the viral genome in the same manner as would an intron-spanning read.
            Last edited by drdna; 10-07-2013, 12:42 AM.

            Comment


            • #7
              You might try a tool such as MapSplice instead. It uses statistics based on the alignments themselves (such as distribution of reads across a junction) rather than any sequence-related measures to validate spliced alignments. It's not hard to use, but can be finicky and can consume its fair share of disk space.

              Comment

              Latest Articles

              Collapse

              • seqadmin
                Improved Targeted Sequencing: A Comprehensive Guide to Amplicon Sequencing
                by seqadmin



                Amplicon sequencing is a targeted approach that allows researchers to investigate specific regions of the genome. This technique is routinely used in applications such as variant identification, clinical research, and infectious disease surveillance. The amplicon sequencing process begins by designing primers that flank the regions of interest. The DNA sequences are then amplified through PCR (typically multiplex PCR) to produce amplicons complementary to the targets. RNA targets...
                Today, 01:49 PM
              • seqadmin
                Targeted Sequencing: Choosing Between Hybridization Capture and Amplicon Sequencing
                by seqadmin




                Targeted sequencing is an effective way to sequence and analyze specific genomic regions of interest. This method enables researchers to focus their efforts on their desired targets, as opposed to other methods like whole genome sequencing that involve the sequencing of total DNA. Utilizing targeted sequencing is an attractive option for many researchers because it is often faster, more cost-effective, and only generates applicable data. While there are many approaches...
                03-10-2023, 05:31 AM
              • seqadmin
                Expert Advice on Automating Your Library Preparations
                by seqadmin



                Using automation to prepare sequencing libraries isn’t a new concept, and most researchers are aware that there are numerous benefits to automating this process. However, many labs are still hesitant to switch to automation and often believe that it’s not suitable for their lab. To combat these concerns, we’ll cover some of the key advantages, review the most important considerations, and get real-world advice from automation experts to remove any lingering anxieties....
                02-21-2023, 02:14 PM

              ad_right_rmr

              Collapse

              News

              Collapse

              Topics Statistics Last Post
              Started by seqadmin, 03-17-2023, 12:32 PM
              0 responses
              12 views
              0 likes
              Last Post seqadmin  
              Started by seqadmin, 03-15-2023, 12:42 PM
              0 responses
              18 views
              0 likes
              Last Post seqadmin  
              Started by seqadmin, 03-09-2023, 10:17 AM
              0 responses
              67 views
              1 like
              Last Post seqadmin  
              Started by seqadmin, 03-03-2023, 12:03 PM
              0 responses
              64 views
              0 likes
              Last Post seqadmin  
              Working...
              X