Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • tophat : sam-flag 115 = properly-paired + read.reverse + mate.reverse ?

    cross posted on biostars: http://www.biostars.org/p/87071

    I ran tophat2 using the standard options.
    Code:
        $ tophat2 -v                                                                    
        TopHat v2.0.10
    Code:
        $ samtools view -H TOPHAT/accepted_hits.bam   | grep PG
        @PG     ID:TopHat       VN:2.0.10       CL:/commun/data/packages/tophat-2.0.10.Linux_x86_64/tophat -p 10 -G genes.gtf -o  TOPHAT --rg-id g24 --rg-library 6VGWT3 --rg-sample 6VGWT3 --rg-description 6VGWT3  34 fastqs --rg-platform-unit 1 2 3 4 --rg-center Nantes --rg-platform Illumina  mm10 6VGWT3_ATGTCA_L002_R1_002.fastq.gz,6VGWT3_ATGTCA_L004_R1_002.fastq.gz,6VGWT3_ATGTCA_L003_R1_002.fastq.gz,6VGWT3_ATGTCA_L002_R1_003.fastq.gz,6VGWT3_ATGTCA_L004_R1_003.fastq.gz,6VGWT3_ATGTCA_L003_R1_003.fastq.gz,6VGWT3_ATGTCA_L002_R1_004.fastq.gz,6VGWT3_ATGTCA_L004_R1_004.fastq.gz,6VGWT3_ATGTCA_L003_R1_004.fastq.gz,6VGWT3_ATGTCA_L004_R1_001.fastq.gz,6VGWT3_ATGTCA_L002_R1_001.fastq.gz,6VGWT3_ATGTCA_L003_R1_001.fastq.gz,6VGWT3_ATGTCA_L001_R1_002.fastq.gz,6VGWT3_ATGTCA_L001_R1_003.fastq.gz,6VGWT3_ATGTCA_L001_R1_004.fastq.gz,6VGWT3_ATGTCA_L001_R1_001.fastq.gz 6VGWT3_ATGTCA_L002_R2_002.fastq.gz,6VGWT3_ATGTCA_L004_R2_002.fastq.gz,6VGWT3_ATGTCA_L003_R2_002.fastq.gz,6VGWT3_ATGTCA_L002_R2_003.fastq.gz,6VGWT3_ATGTCA_L004_R2_003.fastq.gz,6VGWT3_ATGTCA_L003_R2_003.fastq.gz,6VGWT3_ATGTCA_L002_R2_004.fastq.gz,6VGWT3_ATGTCA_L004_R2_004.fastq.gz,6VGWT3_ATGTCA_L003_R2_004.fastq.gz,6VGWT3_ATGTCA_L004_R2_001.fastq.gz,6VGWT3_ATGTCA_L002_R2_001.fastq.gz,6VGWT3_ATGTCA_L003_R2_001.fastq.gz,6VGWT3_ATGTCA_L001_R2_002.fastq.gz,6VGWT3_ATGTCA_L001_R2_003.fastq.gz,6VGWT3_ATGTCA_L001_R2_004.fastq.gz,6VGWT3_ATGTCA_L001_R2_001.fastq.gz
    I found some sam flags= 115 !

    115=
    • read paired
    • read mapped in proper pair
    • read reverse strand
    • mate reverse strand
    • first in pair



    Code:
        $ samtools view  -f 115 -F 256  dir/accepted_hits.bam | head -n 2
        HWI-1KL149:61:D2C11ACXX:4:2204:6848:94129       115     chr1    24611547        1       70M2D31M        chrM    10906   0       GTAGGCGATTAGTGATTTTAAATCTGTTTGGCGTAAGCAGATTGAGCTAGTTATAATTATTCCTCATAGGGAGAAGGATGAAGGGGTATGCTATATATTTT      DDDDDBDDDDDEEEEEEFFFFFFFHHHHJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJIJJJJIJJJJJJJJJJJJJJHHHHHFFFFFCCC      AS:i:-11        XN:i:0  XM:i:0  XO:i:1  XG:i:2  NM:i:2  MD:Z:70^GA31    YT:Z:UU NH:i:4  CC:Z:chrM CP:i:10928       HI:i:2  RG:Z:g24
        HWI-1KL149:61:D2C11ACXX:2:2109:12004:4228       115     chr1    24611549        1       101M    chrM    10815   0       TGGCGATTAGTGATTTTAAATCTGTTTGGCGTAAGCAGATTGAGCTAGTTATAATTATTCCTCATAGGGAGAGAAGGATGAAGGGGTATGCTATATATTTT      DDDDDDDDDDDEEEEEEEFFFFFHHHJJJJJJJJJJJJJJJJJJIJJJJIJJJJJJJJIJJJJIGJJJJJJJJJJIJJJJJJJJJJJJHHHHHFFFFFCCC      AS:i:-5 XN:i:0  XM:i:1  XO:i:0  XG:i:0  NM:i:1  MD:Z:0A100      YT:Z:UU NH:i:4  CC:Z:chrM       CP:i:10928HI:i:2   RG:Z:g24
    how can a read be "mapped in proper pair" and read reverse strand+ mate reverse strand ? what is the consequence for a tool like htseqcount ? Does it only count the reads in proper pair ?

  • #2
    If this is Illumina paired data then yes, properly paired reads should be on opposite strands. For something like Roche 454 (unless preprocessed to act like --> <--paired reads) this could be authentic (the two reads should be from the same strand).

    This smells like a bug to me...
    Last edited by maubp; 11-21-2013, 01:27 PM. Reason: would/could

    Comment

    Latest Articles

    Collapse

    • seqadmin
      Current Approaches to Protein Sequencing
      by seqadmin


      Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
      04-04-2024, 04:25 PM
    • seqadmin
      Strategies for Sequencing Challenging Samples
      by seqadmin


      Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...
      03-22-2024, 06:39 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by seqadmin, 04-11-2024, 12:08 PM
    0 responses
    18 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 04-10-2024, 10:19 PM
    0 responses
    22 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 04-10-2024, 09:21 AM
    0 responses
    17 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 04-04-2024, 09:00 AM
    0 responses
    49 views
    0 likes
    Last Post seqadmin  
    Working...
    X