Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Tallying BLAST Matches

    Hi,

    I've got a custom BLASTDB created from a FASTA file containing large amounts of short sequences:

    >seqA
    GATCGATAGTTAGACTAGTAAGCAAA
    >seqB
    AAATCACAGTGACTAGTAGAGAGATT
    >seqC
    AAGGCCCCTATATAGACTGACTAGTA

    and so on.

    I've sequenced a large library of molecules which are ligation products between 2 of the sequences held in this custom DB i.e. SeqA-SeqC (GATCGATAGTTAGACTAGTAAGCAAAAAGGCCCCTATATAGACTGACTAGTA).

    I need to be able to BLAST my sequencing data against the custom database and then tally how many times each possible ligation product is present and output this based on their FASTA labels i.e. something like this:

    SeqA-SeqC 54
    SeqA-SeqB 102

    Is this something that BLAST/BLAST+ may be able to do instrinsically or is it something that would have to be done in perl/python? Does anybody have a script which may do something similar which I could have a look at to get a framework to build upon?

    Thanks!

    - Julia

  • #2
    I thought of using -max_target_seqs 2 on command-line blastn providing the two top-hits which will represent which 2 sequences gave rise to the ligation products and then outputting this to a custom BLAST format - I am not sure how to proceed from there to obtain the required tally.

    Comment


    • #3
      This mostly depends on what you mean by "large amounts" and "large library".

      If there are fewer than ~100 short sequences, you could probably get away with enumerating (and indexing) all possible combinations (10,000 total), then doing a simple search.

      If you have fewer than ~100,000 short sequences and have predictable start/end points in the library, then you could hash the short sequences and store in memory, then check each ligation product part against the hashed index (unfortunately, using hashes wouldn't allow for errors).

      Otherwise, if the library is less than around 1-5GB, you might be better off reversing the query -- create an index of unique ligation products and map the short sequences to those.

      Comment

      Latest Articles

      Collapse

      • seqadmin
        The Impact of AI in Genomic Medicine
        by seqadmin



        Artificial intelligence (AI) has evolved from a futuristic vision to a mainstream technology, highlighted by the introduction of tools like OpenAI's ChatGPT and Google's Gemini. In recent years, AI has become increasingly integrated into the field of genomics. This integration has enabled new scientific discoveries while simultaneously raising important ethical questions1. Interviews with two researchers at the center of this intersection provide insightful perspectives into...
        02-26-2024, 02:07 PM
      • seqadmin
        Multiomics Techniques Advancing Disease Research
        by seqadmin


        New and advanced multiomics tools and technologies have opened new avenues of research and markedly enhanced various disciplines such as disease research and precision medicine1. The practice of merging diverse data from various ‘omes increasingly provides a more holistic understanding of biological systems. As Maddison Masaeli, Co-Founder and CEO at Deepcell, aptly noted, “You can't explain biology in its complex form with one modality.”

        A major leap in the field has
        ...
        02-08-2024, 06:33 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by seqadmin, Today, 06:12 AM
      0 responses
      13 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 02-23-2024, 04:11 PM
      0 responses
      67 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 02-21-2024, 08:52 AM
      0 responses
      70 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 02-20-2024, 08:57 AM
      0 responses
      61 views
      0 likes
      Last Post seqadmin  
      Working...
      X