Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts

  • dGho
    replied
    Originally posted by dGho View Post

    rs373703898 [Homo sapiens]
    CATTGCTCTGGTCCTGCCTAACAAA[-/TC]TTTTTTTTTTTTTTTTTTTTTTGAG
    Chromosome:
    1:15926507

    rs374926831 [Homo sapiens]
    ATTGCTCTGGTCCTGCCTAACAAAT[-/T]TTTTTTTTTTTTTTTTTTTTTGAGA
    Chromosome:
    1:15926508
    Well the weird thing is that these should not be at the same position? one is at 1:15926507 and the other one at 1:15926508....so they are not actually at 1:15926506 which is what you have in your vcf. Am I wrong? maybe they should not be in the same position...weird. did you figure this out yet?

    Leave a comment:


  • TiborNagy
    replied
    Well, I think one of the incompatible records won't match to the reference. I think you need to filter out those records.

    Leave a comment:


  • dGho
    replied
    I'm sorry. I hope someone else has an answer for you

    Leave a comment:


  • omerfaruk
    replied
    I used combine variants I get that error. Vcf-merge from vcftools didnt help too.

    Leave a comment:


  • dGho
    replied
    Sorry Omer,

    I think we just didn't pay enough attention to the example you posted. I looked up both rs numbers in dbSNP and
    like you said, they are both dbSNP 138 (I just wanted to confirm it for curiosity sake) and just like you had said the difference in rs number is basically just due to the different Amino Acid change:

    rs373703898 [Homo sapiens]
    CATTGCTCTGGTCCTGCCTAACAAA[-/TC]TTTTTTTTTTTTTTTTTTTTTTGAG
    Chromosome:
    1:15926507

    rs374926831 [Homo sapiens]
    ATTGCTCTGGTCCTGCCTAACAAAT[-/T]TTTTTTTTTTTTTTTTTTTTTGAGA
    Chromosome:
    1:15926508

    I am sorry our suggestion was not at all helpful in this case. I think the only suggestion I have is trying different software to merge the vcf. I know vcftools is very popular but I have not always been successful at merging vcfs correctly with it. I recently used gatk CombineVariants and found that it works very well. If you already use gatk and have it installed, then it would be very easy for you to try out.

    Leave a comment:


  • omerfaruk
    replied
    both are 138 and claiming ref is ATC and ATT at different rs ids for dif indels and snps. isnt liftover for 135 to 138 compatibility, fixin?

    I assume my problem is that dbsnp using different ref at same position.

    Basically you say if i use two vcf files which is dbsnp 138 and one formed with gatk dbsnp 138 and I will have no problems? Or I just need liftover? I got that I cant define my real problem here

    Leave a comment:


  • dGho
    replied
    I think Tibor is talking about the dbSNP assembly. dbSNP is regularly updated so there are different versions or "builds/assemblies". For example you using the dbSNP 138 build. The difference in rs number may be because one of the vcfs is referencing an older build such as dbSNP 135, 137, etc. Like Tibor said, software like LiftOver can fix this for you. Good luck!

    Leave a comment:


  • omerfaruk
    replied
    What you mean by "one assembly to another" for 1 15926506 being ATC and ATT?

    Leave a comment:


  • TiborNagy
    replied
    You should use LiftOver to convert positions from one assembly to another.

    Leave a comment:


  • omerfaruk
    started a topic dbSNP 138 same position different reference

    dbSNP 138 same position different reference

    Hello,

    [farukge@bio-hpc05 data]$ grep "1 15926506" dbsnp_138.b37.vcf
    1 15926506 rs373703898 ATC A . . RS=373703898;RSPOS=15926507;d bSNPBuildID=138;SSR=0;SAO=0;VP=0x050000000001000002000200;WGT=1;VC=DIV;OTHERKG
    1 15926506 rs374926831 ATT A,AT . . RS=374926831;RSPOS=15926508;d bSNPBuildID=138;SSR=0;SAO=0;VP=0x050000000001000002000210;WGT=1;VC=DIV;OTHERKG;NOC
    1 159265062 rs2427824 T C . . RS=2427824;RSPOS=159265062;db SNPBuildID=100;SSR=0;SAO=0;VP=0x05012808000115051f000100;WGT=1;VC=SNV;PM;PMC;SLO;INT;VLD;G5;HD;GNO;KG Phase1;KGPilot123;KGPROD;OTHERKG;PH3;CAF=[0.1915,0.8085];COMMON=1

    When I try to merge two vcf, i get error since ref is different for same position. How can I fix this? There are tons of this I assume, fixing a few wont be a solution.

Latest Articles

Collapse

  • SEQadmin2
    Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
    by SEQadmin2



    CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

    Despite this, “CRISPR helped turn genome editing from a specialized technique into
    ...
    07-31-2026, 11:01 AM
  • SEQadmin2
    Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
    by SEQadmin2


    Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

    The systematic characterization of the human proteome has
    ...
    07-20-2026, 11:48 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by SEQadmin2, 08-06-2026, 07:41 AM
0 responses
14 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 08-03-2026, 10:13 AM
0 responses
31 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-31-2026, 02:55 AM
0 responses
40 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-24-2026, 12:17 PM
0 responses
26 views
0 reactions
Last Post SEQadmin2  
Working...