Hi,
Getting this strange error running mapPacBio.sh. The cluster node I'm running it on has 104 cpus, 500GB mem, and 400GB storage. I was getting the same error using 104 cpus so tried lowering it to 48.
The read fasta is 56 GB and the reference fasta is 95 MB.
I've cut down the length of the sequence and 'Sm' string shown.
Thanks,
S.
mapPacBio.sh ref=$CPREF ambig=all nodisk=t nzo=t mappedonly=t minid=0.85 out=bact-bbmap.sam scafstats=cp_bb.mapstats in=$reads fastareadlen=6000 threads=48 maxindel=100 k=15
Loading python3/3.9.2
Loading requirement: intel-mkl/2020.3.304
java -ea -Xmx229788m -cp /g/data/nm31/bin/bbmap/current/ align2.BBMapPacBio build=1 overwrite=true minratio=0.40 fastareadlen=6000 ambiguous=best minscaf=100 startpad=10000 stoppad=10000 midpad=6000 ref=/home/554/ta0341/dy44/r12.18_Roepera_similis/cp-fabids.fasta ambig=all nodisk=t nzo=t mappedonly=t minid=0.75 out=bact-bbmap.sam scafstats=bact_bb.mapstats in=/home/554/ta0341/dy44/r12.18_Roepera_similis/reads.fasta fastareadlen=6000 threads=48 maxindel=100 k=15
Executing align2.BBMapPacBio [build=1, overwrite=true, minratio=0.40, fastareadlen=6000, ambiguous=best, minscaf=100, startpad=10000, stoppad=10000, midpad=6000, ref=/home/554/ta0341/dy44/r12.18_Roepera_similis/cp-fabids.fasta, ambig=all, nodisk=t, nzo=t, mappedonly=t, minid=0.75, out=bact-bbmap.sam, scafstats=bact_bb.mapstats, in=/home/554/ta0341/dy44/r12.18_Roepera_similis/reads.fasta, fastareadlen=6000, threads=48, maxindel=100, k=15]
Version 39.01
Set MINIMUM_ALIGNMENT_SCORE_RATIO to 0.400
Set OUTPUT_MAPPED_ONLY to true
Scaffold statistics will be written to bact_bb.mapstats
Set threads to 48
Retaining all best sites for ambiguous mappings.
Set MINIMUM_ALIGNMENT_SCORE_RATIO to 0.367
Executing dna.FastaToChromArrays2 [/home/554/ta0341/dy44/r12.18_Roepera_similis/cp-fabids.fasta, 1, writeinthread=false, genscaffoldinfo=true, retain, waitforwriting=false, gz=true, maxlen=536670912, writechroms=false, minscaf=100, midpad=6000, startpad=10000, stoppad=10000, nodisk=true]
Set genScaffoldInfo=true
Set genome to 1
Loaded Reference: 0.003 seconds.
Loading index for chunk 1-1, build 1
Indexing threads started for block 0-1
Indexing threads finished for block 0-1
Generated Index: 10.393 seconds.
Analyzed Index: 33.211 seconds.
Started output stream: 1.183 seconds.
Creating scaffold statistics table: 0.036 seconds.
Cleared Memory: 0.175 seconds.
Processing reads in single-ended mode.
Started read stream.
Started 48 mapping threads.
Exception in thread "Thread-43" java.lang.AssertionError: -24, -24
4908336, 1,0,99886506,99894071,0,00,151,154695,351771,0,263804,,mSSSmSSSmSmmmSSSSSSmSSSmmSSmmmSmmmSSmmSSSSSmmmSSSSSmSSSmmSSSmmSSmSSSSSmSSSSSSmSSSSSSmSSSSSSSSSSSmmmSSSSSSSmSSmmSSmSSSSSSSSSSSSSSmmmmmmSmmmmmmmmmSmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmSmmmmmmmmmmmmmmmmSmmmmmmmmmmmmmSSmmmmmmmmmmmmmmmmmmmmSSmSSSSSmmSSSSmmSSmSmSSmSSSSSSSmSSSSmSmSSSSSSSSmmmSSmSSSSSSSSSSSSmSSSmmSSmSSSmmSSSmmSSmmmmmmmSSmmmmSmSmmSmSSSSSmSSSmmSSSSSSmSSSSmmSSSmSSSSmmSmSSSmmSmSSSmSSSmmmSSSSSmSSSmSSSSmmSSmSSSSSSSmSmSSmSSSSSmSmmSSSSmSSSSSSSmSSSmSmmSSSSSmSSSmSSSmmmSSSmSmSSSmmSmSSmSSSSSmSSSmSmmSSmSSSSmSSmSSmmmmSSSSSSSmSmSSSmSmSSSSmmSmSmSmmmmSSSSSSSSSSSSmmSSmSSSmSmSSSSSSmmSmmSSmSSSmmmSSmSSSSSmmSSSSSmSSSmmSSSSmSSSmSmmSS....SSmSm, ATGAAAGAAAATATTCACATAGCTTTGTTTGTTTGATTGGCCT....CCACAAACTACGAAAATTTCTCTTTTTCCTATCTCTATCCAGATCAGCCGAAGCCAAAGCTCTTATTATTTGCTGAGAAATAGCTCGAGTAAG
at align2.TranslateColorspaceRead.realign_new(TranslateColorspaceRead.java:407)
at align2.AbstractMapThread.genMatchStringForSite(AbstractMapThread.java:1043)
at align2.AbstractMapThread.genMatchString(AbstractMapThread.java:923)
at align2.BBMapThreadPacBio.processRead(BBMapThreadPacBio.java:564)
at align2.AbstractMapThread.run(AbstractMapThread.java:522)
Exception in thread "Thread-20" java.lang.AssertionError: -19, -19
9787423, 1,0,91446916,91454472,0,00,84,35773,287063,0,286984,,SSSSmSSSmSSm....SmSm, AGATAGATTAAAATAAAAA....AATATTCATCGTTTAATTCTATAATAGAATGC
at align2.TranslateColorspaceRead.realign_new(TranslateColorspaceRead.java:407)
at align2.TranslateColorspaceRead.realign_new(TranslateColorspaceRead.java:638)
at align2.AbstractMapThread.genMatchStringForSite(AbstractMapThread.java:1026)
at align2.AbstractMapThread.genMatchString(AbstractMapThread.java:923)
at align2.BBMapThreadPacBio.processRead(BBMapThreadPacBio.java:564)
at align2.AbstractMapThread.run(AbstractMapThread.java:522)
Detecting finished threads: 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47
**************************************************************************
Warning! 2 mapping threads did not terminate normally.
Check the error log; the output may be corrupt or incomplete.
Please submit the full stderr output as a bug report, not just this message.
**************************************************************************
------------------ Results ------------------
Genome: 1
Key Length: 15
Max Indel: 100
Minimum Score Ratio: 0.367
Mapping Mode: normal
Reads Used: 12661524 (57423401385 bases)
Mapping: 27513.481 seconds.
Reads/sec: 460.19
kBases/sec: 2087.10
Read 1 data: pct reads num reads pct bases num bases
mapped: 1.9671% 249070 1.9269% 1106468960
unambiguous: 1.8172% 230081 1.8567% 1066207675
ambiguous: 0.1500% 18989 0.0701% 40261285
low-Q discards: 0.0000% 0 0.0000% 0
perfect best site: 0.0023% 288 0.0000% 20624
semiperfect site: 0.0023% 288 0.0000% 20624
Match Rate: NA NA 78.4035% 941243945
Error Rate: 86.9937% 248782 20.7111% 248639475
Sub Rate: 86.8864% 248475 5.4915% 65925963
Del Rate: 83.3997% 238504 7.8336% 94043737
Ins Rate: 83.6599% 239248 7.3860% 88669775
N Rate: 3.2615% 9327 0.8854% 10629277
Exception in thread "main" java.lang.AssertionError:
The number of reads out does not add up to the number of reads in.
This may indicate that a mapping thread crashed.
If you submit a bug report, include the entire console output, not just this error message.
125046+124024+0+12412452+0+0 = 12661522 != 12661524
at align2.AbstractMapper.printOutputStats(AbstractMapper.java:1962)
at align2.AbstractMapper.printOutput(AbstractMapper.java:1060)
at align2.BBMapPacBio.testSpeed(BBMapPacBio.java:491)
at align2.BBMapPacBio.main(BBMapPacBio.java:36)
Seqanswers Leaderboard Ad
Collapse
Announcement
Collapse
No announcement yet.
X
-
Hello,
I'm noticing some non-reproducibility when bbduk is writing gzipped files. The reads appear to be the same, but the output order has changed. This leads to subtle changes in metaphlan abundance levels (changes at the 4th significant didget). Is this intended behavior or a bug? Is there anyway to force bbduk to run in a fully reproducible way?
```
bbduk.sh in=DC001_R1.fastq.gz out=DC001_R1.rep1.fastq.gz ftm=5 tpe tbo qtrim=rl trimq=25 minlen=50 ref=adapters,phix -Xmx16g
bbduk.sh in=DC001_R1.fastq.gz out=DC001_R1.rep2.fastq.gz ftm=5 tpe tbo qtrim=rl trimq=25 minlen=50 ref=adapters,phix -Xmx16g
```
Leave a comment:
-
Thanks for the tool. In comparison to `cutadapt`, I noticed that `bbduk` (using the options below) ran 20x faster, and excluded all of the over-represented sequences that were flagged by FastQC.
```
bbmap/bbduk.sh in1=file_1.fq.gz in2=file_2.fq.gz out1=file_1_trim.fq.gz out2=file_2_trim.fq.gz ref=adapters ktrim=r k=23 mink=11 hdist=1 tpe tbo
```
Are the above options sensible for trimming paired end Illumina RNA-seq?
Should I be using `ktrim=rl` or a lower `k`?
I did not see adapters.fa file in the bbmap folder, so I just used the 'adapters' string as mentioned in the --help description of ref.
I am new to processing this omic at the read level. Thank youLast edited by Kermit; 07-04-2023, 01:15 PM.
Leave a comment:
-
Good day,
I am trying to use BBDuk to remove adapter and to perform quality trimming. The sequencing facility told me that they used the following:
Adapter (Index)
UDI0003
Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Can you help me what command should I use to detect these adapters and to trim the reads @Q10?
Thank you!
Leave a comment:
-
Hello, I am trying to use bbnorm to normalize a very large dataset - 657G per paired-end file. I've been given access to a node with 208 cores and 5888 GB RAM and I assumed it would be able to process the files, but I keep getting the following error:
Exception in thread "Thread-1407" java.lang.RuntimeException: java.io.IOException: No space left on device at stream.ReadStreamByteWriter.run(ReadStreamByteWriter.java:32)
Caused by: java.io.IOException: No space left on device (more lines follow - I can share them if they'd be helpful.)
It continues to run and later on prints again
Exception in thread "Thread-1408" java.lang.RuntimeException: java.io.IOException: No space left on device at stream.ReadStreamByteWriter.run(ReadStreamByteWriter.java:32)
Caused by: java.io.IOException: No space left on device
Then later on I get the following:
Exception in thread "Thread-1497" java.lang.RuntimeException: Writing to a terminated thread.
I ended the run at this point because I wasn't sure if the output would be viable or what exactly was happening. I was wondering a few things:
1) Should I let it keep running? Will the output be usable?
2) If the node I'm using isn't sufficient, is there a way to figure out what would be? When I ran loglog.sh, I got the following: Cardinality: 45491636111 which I calculate to mean that I'd need roughly 500 GB of RAM with the default parameters. (Assuming I made the correct calculation.)
3) Are there changes I can make to the command to lessen the load? I tried increasing the min from 5 to 10 with no success, and then I tried decreasing the hash number from 3 to 2 and then to 1 - again with no change in result.
Here is the command I used:
HTML Code:bbnorm.sh prefilter=TRUE in1=${WDIR}/${JB}_R1_001.clean.fastq in2=${WDIR}/${JB}_R2_001.clean.fastq out1=${WDIR}/${JB}_R1_001.norm.fastq out2=${WDIR}/${JB}_R2_001.norm.fastq target=100 min=5
Thank you so much!
Leave a comment:
-
Hi Brian,
I ran filterbyname.sh to extract some FastQ reads from a bigger FastQ file and I noticed that on the quality line of the output, the # (hashtag symbol) gets replaced by an ! (exclamation mark symbol). I checked the documentation and the forums about this behaviour but couldn't find anything.
Is this expected? If so, why?
Mine were latest FastQ files produced by BaseSpace from an Illumina MiSeq instrument.
Thanks in advance.
Best,
Santiago
Leave a comment:
-
Hi Brian Bushnell, thank you very much for developing BBMap. It is such a useful tool!
I am trying to map sequencing reads to a metagenome I had previously assembled and I am getting a very strange output. After running the alignment, I also ran pileup.sh to obtain coverage stats and I got the following output:
Code:pileup.sh in=mapped.sam out=stats.txt Reads: 18093134 Mapped reads: 3652730 Mapped bases: 331276393 Ref scaffolds: 134515 Ref bases: 43282856 Percent mapped: 20.188 Percent proper pairs: 12.341 Average coverage: 7.654 Average coverage with deletions: 7.689 Standard deviation: 9.676 Percent scaffolds with any coverage: 99.51 Percent of reference bases covered: 99.34
Thanks in advance with any help you might be able to provide,
Esteban
- Likes 2
Leave a comment:
-
Brian Bushnell Thanks for providing this very useful toolset.
I have a few questions wrt the use of BBSplit, and I guess it's OK to put them in a single post...
[Edited: well, there has been no reply for a while and I figured out some of the answers myself, and I add them below just in case someone else run into the same problems...]
1. Is there any recommendation in terms of computation resource allocation and speeding up a run? For human+mouse genome (a total of 5.6GB .fasta files) and decompressed fastq files at about 50GB each (paired-end), I found that nearly 200GB memory was needed when using 1 thread, and it can take several days or even up to a week to run. Is this normal/expected?
[Edited: in one of my later applications where I only needed to map one of the read-pairs (decompressed at around 50G), I managed to increase the number of threads to 16, with 10G memory per thread, setting java heap size around 50G, and BBSplit finished running overnight.]
2. From the user guide I read that the `maxindel` parameter should be set to a large number for RNA-seq (e.g. 200k for human according to the guide). Another example in the guide for BBMap says:
Code:To map vertebrate RNA-seq reads to a genome: bbmap.sh in=reads.fq out=mapped.sam maxindel=200k ambig=random intronlen=20 xstag=us
3. I have this problem on re-using genome index as follows:
In this post, someone asked:
After running bbsplit once using the syntax: ref=ref1.fa,ref2.fa, is it possible to re-use that index on subsequent runs using the path= parameter?
Yes, it is. Also, with BBSplit, I think it will try to regenerate the index every time as long as "ref=" is specified, even if it already exists, so only do that once.
Let's say I first build an index for two reference genomes, x.fa and y.fa as follows:
Code:bbsplit.sh build=1 ref=x.fa,y.fa path=./test
Code:bbsplit.sh in1=r1.fq in2=r2.fq basename=o%_#.fq build=1 path=./test
Code:NOTE: Deleting contents of ./test/ref/genome/1 because reference is specified and overwrite=true NOTE: Deleting contents of ./test/ref/index/1 because reference is specified and overwrite=true Writing reference. Executing dna.FastaToChromArrays2 [ref/genome/1/merged_ref_1939486580590361.fa.gz, 1, writeinthread=false, genscaffoldinfo=true, retain, waitforwriting=false, gz=true, maxlen=536670912, writechroms=true, minscaf=1, midpad=300, startpad=8000, stoppad=8000, nodisk=false] Set genScaffoldInfo=true Writing chunk 1 Writing chunk 2 ......
Besides, I also have a related question, which is whether I can pre-build indices separately for two genomes x.fa and y.fa, saved in different paths or with different build numbers, and then later reuse them for aligning with BBSplit (potentially with something like `build=1,2` or `path=<first_path>,<second_path>`).
[Edited: I figured this out. I first build the index with `bbsplit.sh ref=x.fa,y.fa`, which generated the index in a folder named `ref`, then in the subsequent BBSplit run for each sample organized in its own sample-specific dir, I first link the `ref` folder to the sample dir, then from the sample dir run with something like `bbsplit.sh ref=x.fa,y.fa in1=r1.fq in2=r2.fq basename=o%_#.fq`, now BBSplit can find the index without any issue.]
I am using BBMap version 39.01, the latest version to date.
I appreciate your kind help in advance.Last edited by KenC; 11-14-2022, 12:43 AM.
Leave a comment:
-
Is there anything else I need to do to test some Java changes to debug where the issue is happening?
For example, I would like to turn on verboseS=t and have it spit out debug info. I think the pairlen (MAX_PAIR_DIST) is just not being applied from what I can tell from verbose=t output.
Leave a comment:
-
Thank you for the response Brian Bushnell !
We are using the "pairedonly=t" flag, however the reads are still returned with PROPER_PAIR in the SAM file (sam flags 83 and 163).
It appears the MAPQ is penalized, probably due to the repetitive sequence in read2, however the reads are still shown as properly paired.
Maybe you'll spot something in the arguments below?
I've tried all combinations and all SAM alignments have the tag PROPERLY_PAIRED, and are included in the mapped output.
You can see I also added killbadpairs=t and pairedonly=t, but maybe something else has gone wrong.
Code:bbmap.sh \ in=testA_1.subset.fq.gz in2=testA_2.subset.fq.gz \ ref=/reference_genomes/mm39/mm39canonical.fa \ path=/reference_genomes/mm39/bbmap_mm39canonical/ \ out=testA.subset.mm39.maxindel20.pairlen35000.matelen33000.mapped.bam \ outu=testA.subset.mm39.maxindel20.pairlen35000.matelen33000.unmapped.bam \ mappedonly=t \ trimreaddescriptions=t \ t=3 \ maxindel=20 \ strictmaxindel=t \ inserttag=t \ matelen=33000 \ pairlen=35000 \ intronlen=999999999 \ ambig=random \ minid=0.76 \ killbadpairs=t \ pairedonly=t \ covstats=testA.subset.mm39.maxindel20.pairlen35000.matelen33000.mapped.bbmap_covstats.txt \ covhist=testA.subset.mm39.maxindel20.pairlen35000.matelen33000.mapped.bbmap_covhist.txt \ ihist=testA.subset.mm39.maxindel20.pairlen35000.matelen33000.mapped.bbmap_inserthist.txt \ statsfile=testA.subset.mm39.maxindel20.pairlen35000.matelen33000.mapped.bbmap_alignmentReport.txt \ 2>&1 | tee -a output_testA.subset.mm39.maxindel20.pairlen35000.matelen33000.mapped_bbmap.txt
Code:testA.subset.mm39.maxindel1400.pairlen1200.matelen1000.mapped.bam QNAME FLAG RNAME POS MAPQ CIGAR RNEXT PNEXT TLEN SEQ QUAL FLAGS testA.subset.mm39.maxindel20.pairlen35000.matelen33000.mapped.bam NS500489:195:HLKT3BGXX:1:12109:18917:8143 83 chr5 11805066 2 3X4=1X2=1X4=2X2=3X29= = 11375902 -429215 ACATGCCAAAATAACAACCCACTTTTAAGTGTATAATTCATTACACAATGC //AE//E//E/E/E///EE///EEEEEEEEEEEEEEEEEEEEEEEEAAAAA XT:A:R NM:i:10 AM:i:2 X8:Z:429215 NS500489:195:HLKT3BGXX:1:12109:18917:8143 163 chr5 11375902 3 51= = 11805066 429215 GACAGAGACAGAGAGAGGAACATAGACAGAGACAGAGAGAGGAACATAGAC AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEE/E/E/E/EE/E XT:A:R NM:i:0 AM:i:3 X8:Z:429215 NS500489:195:HLKT3BGXX:1:11102:2182:13318 99 chr17 20345318 42 51= = 20345469 202 ACTGGTGGCCTTATAACTTGTGTAATAAGAAATGTTTGAGTTTAACTATAA AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE NM:i:0 AM:i:42 X8:Z:202 NS500489:195:HLKT3BGXX:1:11102:2182:13318 147 chr17 20345469 42 51= = 20345318 -202 AGCTAAGAAATAGTGAGAGCTGTGAAAATTATTCTTTCCCAGGAAGGGTAG AEEEEAEEEEEEEEEEEEEEEEAEEEEEEEEEEE6EEEEEEE/EEEAAAAA NM:i:0 AM:i:42 X8:Z:202
Leave a comment:
-
Oh, that flag might be a little misleading... it's the maximum distance for reads to be considered as 'proper pairs'. Beyond that the mapq is penalized, alternative sites are prioritized, and the 'proper pair' flag bit is not set. If you want to ban pairs from mapping at all beyond that distance you need to use either the 'killbadpairs' (which will mark one of the two as unmapped) or 'pairedonly' (which will mark them both as unmapped) flag.
- Likes 1
Leave a comment:
-
Hi Brian Bushnell thanks again for the BBTools suite, it's really amazing! Lots of configurable settings, fantastic speed, logic, use of kmers, it's got it all. I'm replacing various bits of our pipelines with BBTools equivalents, and so far really loving the improvements. Also enjoyed reading through the various forum posts and responses, impressive support for the tool over the years. I digress.
I cannot figure out how to get bbmap.sh to filter paired read alignments greater than 32000 distance, which is what I understood the pairlen=32000 argument is supposed to do. It just doesn't filter out alignments. For example, one alignment shows BAM TLEN=429215 for read1 (and -429215 for read2), and there is even the optional tag X8:Z:429215. All consistent. And even with or without read lengths in the distance calculation it should be well over the cutoff (I understood pairlen was distance between read ends pointing toward each other).
Am I using the wrong argument? pairlen=32000 is default, even setting it to pairlen=40000 or pairlen=20000 it doesn't appear to do anything, or not what I expected anyway.
Thanks in advance for the help!
-James
Leave a comment:
-
Originally posted by Thias View PostI think you found a bug ...
When you look at the given line 625 in the file ./current/shared/TrimRead.java, it evaluates the CIGAR string and asserts that it ends with a match (M or =). This should be the case because the trimReadWithMatchFast() function is only invoked for 100% match or unmapped reads:
Code:char c=sl.cigar.charAt(sl.cigar.length()-1); assert(c=='M' || c=='=') : c+"; "+sl.cigar+"\n"+sl;
- Likes 2
Leave a comment:
-
I think you found a bug ...
When you look at the given line 625 in the file ./current/shared/TrimRead.java, it evaluates the CIGAR string and asserts that it ends with a match (M or =). This should be the case because the trimReadWithMatchFast() function is only invoked for 100% match or unmapped reads:
Code:char c=sl.cigar.charAt(sl.cigar.length()-1); assert(c=='M' || c=='=') : c+"; "+sl.cigar+"\n"+sl;
- Likes 1
Leave a comment:
-
Hi Brian Bushnell
I recently installed BBMap_38.98.tar.gz from SourceForge on a machine running Ubuntu 20.04.4 LTS.
Per the usage guide, I checked my current version of Java with "java -Xmx90m -version" which returned the following:openjdk version "11.0.15" 2022-04-19
OpenJDK Runtime Environment (build 11.0.15+10-Ubuntu-0ubuntu0.20.04.1)
OpenJDK 64-Bit Server VM (build 11.0.15+10-Ubuntu-0ubuntu0.20.04.1, mixed mode, sharing)
I tried running reformat on a sam file with a command like:reformat.sh in=in.sam out=out.sam forcetrimleft=10
And got the following error:java -ea -Xms300m -cp /data/usr/croy/tools/bbmap/current/ jgi.ReformatReads in=in.sam out=out.sam forcetrimleft=10
Executing jgi.ReformatReads [in=in.sam, out=out.sam, forcetrimleft=10]
Input is being processed as unpaired
Waiting on header to be read from a sam file.
Exception in thread "main" java.lang.AssertionError: H; 22M123H
FS10001085:123:BRL95608-3321:1:1101:7680:1000 2195 chr3 50608025 18 22M123H = 50607939 -98 AGTGGTTTTCACTGACAGCGTG F,:FFFFFFFF::FFF:F,F,F NM:i:0 MD:Z:22 MC:Z:93M21D52M AS:i:22 XS:i:0 SA:Z:chr3,50608053,-,17S128M,60,1;
at shared.TrimRead.trimReadWithMatchFast(TrimRead.java:625)
at shared.TrimRead.trimReadWithMatch(TrimRead.java:684)
at shared.TrimRead.trimByAmount(TrimRead.java:279)
at shared.TrimRead.trimToPosition(TrimRead.java:240)
at jgi.ReformatReads.process(ReformatReads.java:919)
at jgi.ReformatReads.main(ReformatReads.java:53)
The sam file was aligned to hg38 using a recent version of BWA MEM (v0.7.17-r1188). The CIGAR string seems to follow the SAM specs as far as I can tell, so I'm not sure where things are going wrong.
Please let me know if you need any more information.
Best,
Charles
Leave a comment:
Latest Articles
Collapse
-
by seqadmin
Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...-
Channel: Articles
03-22-2024, 06:39 AM -
-
by seqadmin
The field of conservation genomics centers on applying genomics technologies in support of conservation efforts and the preservation of biodiversity. This article features interviews with two researchers who showcase their innovative work and highlight the current state and future of conservation genomics.
Avian Conservation
Matthew DeSaix, a recent doctoral graduate from Kristen Ruegg’s lab at The University of Colorado, shared that most of his research...-
Channel: Articles
03-08-2024, 10:41 AM -
ad_right_rmr
Collapse
News
Collapse
Topics | Statistics | Last Post | ||
---|---|---|---|---|
Started by seqadmin, Yesterday, 06:37 PM
|
0 responses
10 views
0 likes
|
Last Post
by seqadmin
Yesterday, 06:37 PM
|
||
Started by seqadmin, Yesterday, 06:07 PM
|
0 responses
9 views
0 likes
|
Last Post
by seqadmin
Yesterday, 06:07 PM
|
||
Started by seqadmin, 03-22-2024, 10:03 AM
|
0 responses
51 views
0 likes
|
Last Post
by seqadmin
03-22-2024, 10:03 AM
|
||
Started by seqadmin, 03-21-2024, 07:32 AM
|
0 responses
67 views
0 likes
|
Last Post
by seqadmin
03-21-2024, 07:32 AM
|
Leave a comment: