Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Some "QNAME" information lost after mapping by Bsmap

    Dear All

    I mapped my bisulfited DNA sequencing reads by Bsmap, the out put file was SAM format. Before that, I trimmed 18bp repeat reads.But after mapping, some information in the "QNAME" lost.

    Here is an example

    Trimmed reads mapping

    ILLUMINA-XXXXX3:7:FC665XXXXXX:1:1 345 chr17 7111078 255 51M * 0 0 ACACACATACATACACACATACACAGGCCTTCACCAAACACACCCAACGNA BGDGDGGGEGGDDGDGEGGGEHHHHHGGGGGGFGGGGGGGG7<>7>>>(#> NM:i:10 ZS:Z:-+

    unTrimmed reads mapping

    ILLUMINA-XXXXX3:7:FC665XXXXXX:1:18:11311:15796 153 chr19 42422318 255 101M * 0 0 TGGTGTATGTGGGGTGTACACATACCTCTCATGTATACGCCACATATACACCACACATACCACATATACACACCACAGACAAACCAAACACACCCAACACA DG@BDBBCACFF@FDFFBF3324*53/)'*315/HGEIHDBBDDDBIDI?CC@<EGDECGDBGGDGGBEBG>GG@<BGDFIIEIIIIIIIIHIIIIIIGII NM:i:13 ZS:Z:+-


    The red part lost in the sam file which generated by trimmed reads. So someone know what happen here?

    Any help would be greatly appreciated!

  • #2
    What tool/command did you use for trimming? And can you paste a read from the trimmed fastq? It sounds like you're trimming headers in addition to bases.

    Comment


    • #3
      Originally posted by Brian Bushnell View Post
      What tool/command did you use for trimming? And can you paste a read from the trimmed fastq? It sounds like you're trimming headers in addition to bases.
      Thank you for replying.

      The trimmed fastq reads are followed.

      @ILLUMINA-8XXXXX:7:FCXXXXXAXX:1:1:6136:1035 1:N:0:GTGAAA
      GTACCTGTGTAAGTGTATGCATGTATGCGAATGTATGTGTATGTGCATGTGAATGTATGTATGTGTGTATGTGCA
      +
      GGGGGGGGGGGGGDIIGIGIIIIHBEGEG>GGEG<GGDDD@GB@G?<G@B@;-BDEDEDGDDG?GG,E@=F##

      @ILLUMINA-8XXXXX:7:FCXXXXXAXX:1:1:7632:1039 1:N:0:GTGAAA
      TGTTGGGTGTGTTGGGTGTGTTGGGTGTGTGTGTGTGTGTGTGTGTGTGGTGTGTGGTGTGTGTGTGTGTGTGTGCGGTGTGTGTGTGTGTGTGTGTGT
      +
      C>CEF?BBGGGGEGGGDGDGGGGGGDGGGGGGGGGGGDGEGCGDGGGDGGGDGG>EFAECGCFEFCDCEFE>F3B6?BDD@BD0@=0=,B=B=2=B?BB
      @ILLUMINA-8XXXXX:7:FCXXXXXAXX:1:1:6672:1077 1:N:0:GTGAAA
      ATGTGTATGTATGTATGTATGTGTATGTGTGTATATGTGTGTGTATGTGTGTATATGTGTGTGTGTGTGTGTTGA
      +
      DGGGGDGGGFGGGGBHGHHHHGHHBGGBGEGD>GBGGEGEGEGEGGGBDDGDD>GGGDGBGBGDGDGBGBG>EGD
      @ILLUMINA-8XXXXX:7:FCXXXXXAXX:1:1:15911:1085 1:N:0:GTGAAA
      GTTGGGTGTGTTTGGGTTTGTGGTGTGTTGTGTGTGTATGTATGCATGTGTGTTTATGTGTTGTTATCTTCACATTTGTATGATTCATGCGGGCTGTCT
      +
      @A@=@<7@>B=;3EA7EEGGGGGE?EDDEEB?EGG=GGEB<>E3=@BAG?DB<:>ACBB=EE:/+@=4@;.40-5258;>+CA;?=:B###########

      @ILLUMINA-8XXXXX:7:FCXXXXXAXX:1:1:18002:1087 1:N:0:GTGAAA
      TGTTGGGTGTGTTGGGTGTGTATGTATGTGTATGTGTGTATATGTGTGTGTATGTAGTTTCAAAAACATACGCCCAAGACCACAAGTACAGATACATCT
      +
      B?BFFFEBGGGGGDGG8GGGGGGGGGGGGGGGGHHHHHHHH?GHHHEHGHHG@GGGGFEGG?DGDGEAAGB:BCEDE?F=AF@BBD?D8FFD#######

      @ILLUMINA-8XXXXX:7:FCXXXXXAXX:1:1:7076:1090 1:N:0:GTGAAA
      GGGTGGATTGAAGCATGGAATATATAGATTCAAATATGGGTCACACACACAGCTGCCACCCGCCAGTATCTGAAG
      +
      @?D5=@=BDDBDDDDDDD<DD@D<DDBDD@DD6BB4B@>BDB:?=4B=?@DBB0ABDD@)4912>B>:B*<=D

      We write a code by Python to trim the repeat reads. We didn't remove any info. from the fastq title line.

      I just guess something wrong in the format.

      Thanks a lot!

      Comment

      Latest Articles

      Collapse

      • seqadmin
        Best Practices for Single-Cell Sequencing Analysis
        by seqadmin



        While isolating and preparing single cells for sequencing was historically the bottleneck, recent technological advancements have shifted the challenge to data analysis. This highlights the rapidly evolving nature of single-cell sequencing. The inherent complexity of single-cell analysis has intensified with the surge in data volume and the incorporation of diverse and more complex datasets. This article explores the challenges in analysis, examines common pitfalls, offers...
        06-06-2024, 07:15 AM
      • seqadmin
        Latest Developments in Precision Medicine
        by seqadmin



        Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

        Somatic Genomics
        “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
        05-24-2024, 01:16 PM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by seqadmin, Today, 07:23 AM
      0 responses
      8 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 06-17-2024, 06:54 AM
      0 responses
      11 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 06-14-2024, 07:24 AM
      0 responses
      24 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 06-13-2024, 08:58 AM
      0 responses
      17 views
      0 likes
      Last Post seqadmin  
      Working...
      X