Hi I would like to know is there any tool for removing the unpaired fastq reads from a huge set of paired end fastq data?
Header Leaderboard Ad
Collapse
removal of unpaired reads
Collapse
Announcement
Collapse
No announcement yet.
X
-
You said huge, but how many reads are there (roughly)? One million? Ten million? More?
Would a Python script using Biopython be useful? It would help to show a small sample of the reads (say the first ten) to ensure I understand your read naming convention. You can wrap the example with [ code ] and [ /code ] tags to format it nicely on the forum.
Comment
-
About 50 million reads... that would make any approach using a list of IDs in memory rather tricky.
Can we assume the read pairs are next to each other, e.g. you started out with this:
Code:read1.f read1.r read2.f read2.r read3.f read3.r read4.f read4.r read5.f read5.r
Code:read1.f read1.r read2.r read3.f read4.f read4.r read5.r
Code:read1.f read1.r read4.f read4.r
If the reads are in a random order, things will be much harder...
Comment
-
This is a general slow version (you can switch "fastq" to any other supported file format like "fasta" or "qual"):
Code:from Bio import SeqIO mixed_file = "mixed.fastq" paired_file = "paired.fastq" def get_paired(iterator): prev = None for curr in iterator: if curr.id.endswith("/1"): prev = curr elif not curr.id.endswith("/2"): raise ValueError("Expect IDs to end /1 and /2") elif prev and prev.id == curr.id[:-2] + "/1": yield prev yield curr prev = None records = get_paired(SeqIO.parse(mixed_file, "fastq")) count = SeqIO.write(records, paired_file, "fastq") print "Saved %i records (%i pairs)" % (count, count/2)
Code:from Bio.SeqIO.QualityIO import FastqGeneralIterator mixed_file = "mixed.fastq" paired_file = "paired.fastq" out_handle = open(paired_file, "w") prev = None for curr in FastqGeneralIterator(open(mixed_file, "rU")): if curr[0].split()[0].endswith("/1"): prev = curr elif not curr[0].split()[0].endswith("/2"): raise ValueError("Expect IDs to end /1 and /2,\n%s" % curr[0]) elif prev and prev[0].split()[0] == curr[0].split()[0][:-2] + "/1": out_handle.write("@%s\n%s\n+\n%s\n" % prev) out_handle.write("@%s\n%s\n+\n%s\n" % curr) prev = None out_handle.close()
This was written and tested using Biopython 1.54beta, should be fine on Biopython 1.51 or later. I've only used a 500MB test file - it took about 30s.
If you are willing to make more assumptions about the file layout, or skip the minimal error checking, I could make this faster still - but I would need to see a sample of the data as suggested before (e.g. the first ten reads).
Comment
-
Another way to do this: first run tophat, and check the accepted_hits.sam and delete the line with "*"
HWI-EAS266_0005:1:32:2465:21083#0 177 chr1 120 255 42M = 199385343 0 AAACCCTAACCCTAACCCTAACCCTAACCCCTAACCCTAACC ^^[YVRK[bb^bbbb_babbb^bbbbbbaabbcbbb`bbbba NM:i:1
HWI-EAS266_0005:1:59:17297:6482#0 177 chr1 120 255 42M = 199385343 0 AAACCCTAACCCTAACCCTAACCCTAACCCCTAACCCTAACC ORXYaa\__bbbTbabbb`b[bbb``abbbbbb_bbb`b^bb NM:i:1
HWI-EAS266_0005:1:3:4093:8164#0 145 chr1 550 255 42M = 241327181 0 GTGCAGAGGAGAACGCAGCTCCGCCCTCGCGGTGCTCTCCGG Rbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbb NM:i:1
HWI-EAS266_0005:1:60:8918:19240#0 145 chr1 550 255 42M = 241327181 0 GTGCAGAGGAGAACGCAGCTCCGCCCTCGCGGTGCTCTCCGG BBBBa_\`a_`a[a[_aaaXTa```a_a[a_]]_`T]`__aa NM:i:1
HWI-EAS266_0005:1:79:5108:21091#0 73 chr1 1146 1 42M * 0 0 GCGCCCCCTGCTGGCGCCGGGGCGCTGCAGGGCCCTCTTGCT aQ_a`^ca_`a__c]`\cbbbbbb^bbb]ba^abbbbbbbbb NM:i:1
HWI-EAS266_0005:1:8:7442:18432#0 73 chr1 1168 1 42M * 0 0 CACTGCAGGGCCCTCTTGCTTACTGTATAGTGGTGGCACGCC _Sb_ab]bbb^_ba^b_b\`V]\b``b_ababbbababbbb` NM:i:0
HWI-EAS266_0005:1:35:18364:16230#0 147 chr1 1303 255 42M = 1458 0 TTCTTGCTCCAACAGTAGTGGCGGATTATAGGGAAACACCCG B_bb`bbcbbbbbcbbbbbcbbbbb`bbbbbbbabababbbb NM:i:2
HWI-EAS266_0005:1:26:17783:8912#0 137 chr1 1585 0 42M * 0 0 GGTATTTTTTTAAATTTCCACTGATGATTTTGCTGCATGGCC BBBBBababaaaa_bb]bb`bbbacbbbcc_bc`bbcbbbbb NM:i:1
Is this method reasonable?
Comment
-
I have tried to run your script but the problem is that my file does not have the /1 or /2 ending. In my case the file is told with 1 or 2 before the N on the last letters of the file (bold) have two separate fastq files which look like:
File 1:
@M00289:3:000000000-A752F:1:1102:13093:3364 1:N:0:20
GGCTGTGATCACGGGGCAAAACAGCCACTTCATTAACTTTCAGTAAGGGCTGCAAGGTAACTCCAGCAGGTGCCTTTTGTGTTTCACTCAACCCTAGGTCAAAACGTTGTTCACTCATGGCTTGTTCCAACCAAGGCGACTCTAAGG
+
BCCCBCFFFFFFGGGGGGGGGGHHHHHHHHHHHHHHHHHHHHHGHHHHHGHGGHHHGGHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHGHHHHHHHHHHHGHHHGHHHHHHHHHHHHHGGHHHHHHGGHHGHGGGGGHHHHH
@M00289:3:000000000-A752F:1:1110:7454:18361 1:N:0:20
ATCTCAACGCGTCCAAATGAGGCATCGCTGTATTCAGGTTACTTTACATAAGAGTTTTTATGTTAAATAGGACTAAAAATATACTCTAATTTTAGAGTTTTCTTTTAGGTATGATGTAAAAACATACAAGCCTAAGAGTTTAATTTAAAGG
+
CCCCCFFFDDDDGGGGGGGGGGGGHHGGHGGHHHHHHHHHHHHHHHHHHHHHHHHHHHGHHHGHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHGHHHHHHHHGHHHHHHHHHHGHHHHHHGG
FIle 2:
@M00289:3:000000000-A752F:1:1112:9370:8062 2:N:0:20
CCACACCCCCTGCAGAGCGTTCTCGCAGACACAGTCCGCAAAGCCAGTGCCGACTTGAGCCACCTTGACCAGTGTTTTTATTAGAACTAGAAACTAGAGGATTTGTTGCAC
+
BBCDDCCEDEEEGGGGGGGGGGGHGGGGGHHHHHHHHGGGGGHHHFHGHHHGCGGGHHHHHHHHHHHGHHHHHGGHHHGHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH
@M00289:3:000000000-A752F:1:1114:14694:7357 2:N:0:20
TAATTTAACTGTAGTTCATCCGCATTTTCCCCTCTAATGCCCCAGTTTTCTTTAGGGGTTTCAAATATAGTTATCTCAACATCAT
+
BBBBCFFFFFFFGGGGGGGGGGGGGGHHHHHHHGHHHHHHHHGGGHHHHHHHHHHHGGEGGHHHHHHHHHHHHHHHHHHHHHHFH
@M00289:3:000000000-A752F:1:1102:13093:3364 2:N:0:20
CCTTAGAGTCGCCTTGGTTGGAACAAGCCATGAGTGAACAACGTTTTGACCTAGGGTTGAGTGAAACACAAAAGGCACCTGCTGGAGTTACCTTGCAGCCCTTACTGAAAGTTAATGAAGTGGCTGTTTTGCCCCGTGATCACAGCC
+
BBBBCFFFFFCDGGGGGGGGGGHHHHHHGHHHHHHHHHHHHHGHHHGHGHHGHHHHHHGHHGHHHHHHHHGHHHGHHHGHHHHHHHHHHHHHHHHHFHHHGGHHHHHHHHHHHHHHHHHGHHHGHG0FGH03GHGF<DC2FFGHHHH
As you can see the reads are not correlative in each file so I supposse this makes the thing more complicated. My files are not very big (5.2Mb and 5.4 Mb respectively) so I wonder if you know a way for selecting only the ones which have data for both ends.
This next script should be about four times faster, but is only suitable for FASTQ files:
Code:from Bio.SeqIO.QualityIO import FastqGeneralIterator mixed_file = "mixed.fastq" paired_file = "paired.fastq" out_handle = open(paired_file, "w") prev = None for curr in FastqGeneralIterator(open(mixed_file, "rU")): if curr[0].split()[0].endswith("/1"): prev = curr elif not curr[0].split()[0].endswith("/2"): raise ValueError("Expect IDs to end /1 and /2,\n%s" % curr[0]) elif prev and prev[0].split()[0] == curr[0].split()[0][:-2] + "/1": out_handle.write("@%s\n%s\n+\n%s\n" % prev) out_handle.write("@%s\n%s\n+\n%s\n" % curr) prev = None out_handle.close()
This was written and tested using Biopython 1.54beta, should be fine on Biopython 1.51 or later. I've only used a 500MB test file - it took about 30s.
If you are willing to make more assumptions about the file layout, or skip the minimal error checking, I could make this faster still - but I would need to see a sample of the data as suggested before (e.g. the first ten reads).[/QUOTE]Last edited by chariko; 08-05-2014, 07:15 AM.
Comment
-
Originally posted by chariko View PostI have tried to run your script but the problem is that my file does not have the /1 or /2 ending. In my case the file is told with 1 or 2 before the N on the last letters of the file (bold) have two separate fastq files which look like: ...
As you can see the reads are not correlative in each file so I supposse this makes the thing more complicated. My files are not very big (5.2Mb and 5.4 Mb respectively) so I wonder if you know a way for selecting only the ones which have data for both ends.
I have a related Python script (which has a Galaxy wrapper) which knows more naming schemes, but it expects the reads to be sorted/interleaved - yours are more mixed up:
Do you have the original Illumina FASTQ files before whatever processing was done to them?
Peter
Comment
-
Originally posted by maubp View PostIllumina changed their naming schema. There are scripts out there to convert this back to the /1 and /2 style (even as Unix one-line commands with sed or awk).
I have a related Python script (which has a Galaxy wrapper) which knows more naming schemes, but it expects the reads to be sorted/interleaved - yours are more mixed up:
Do you have the original Illumina FASTQ files before whatever processing was done to them?
Peter
Comment
-
Either use a pair-aware filtering pipeline, or, I suggest:
1. Interleave the pairs (one FASTQ file with r1, r2, r1, r2, etc)
2. Filter the interleaved file (preserving the original order)
3. Run https://github.com/peterjc/pico_gala...aired_unpaired
Comment
-
Originally posted by chariko View PostI have tried to run your script but the problem is that my file does not have the /1 or /2 ending. In my case the file is told with 1 or 2 before the N on the last letters of the file (bold) have two separate fastq files
Comment
-
Thanks SES for your suggestion. I will try it also.
Anyway, I finally made it work by doing the following:
First I changed my ending form 1:N to /1 and 2:N to /1 and /2 with:
gawk '{print((NR % 4 == 1) ? $1"/1" : $0)}' Sample1_R1.fq > Sample1_newtags_R1.fq
gawk '{print((NR % 4 == 1) ? $1"/2" : $0)}' Sample1_R2.fq > Sample1_newtags_R2.fq
(https://wikis.utexas.edu/display/bio...nux+one-liners).
I interleaved the pairs using the script interleave_fastq.py (https://gist.github.com/ngcrawford/2232505).
I filter my fastq file using the following script:
(https://github.com/brentp/bio-playgr...r/reads-utils/)
the problem is that the filtered file does not mantain the order of paired reads so you will have it to do it manually (in my case with Excel).
And finally after installing galaxy locally I run the galaxy script made by maubp.
When running again fastqc with my files, the duplication levels where ok.
Thanks a lot for your suggestions.Last edited by chariko; 08-08-2014, 06:44 AM.
Comment
Latest Articles
Collapse
-
by seqadmin
Cancer research has been transformed through numerous molecular techniques, with RNA sequencing (RNA-seq) playing a crucial role in understanding the complexity of the disease. Maša Ivin, Ph.D., Scientific Writer at Lexogen, and Yvonne Goepel Ph.D., Product Manager at Lexogen, remarked that “The high-throughput nature of RNA-seq allows for rapid profiling and deep exploration of the transcriptome.” They emphasized its indispensable role in cancer research, aiding in biomarker...-
Channel: Articles
09-07-2023, 11:15 PM -
-
by seqadmin
Ribonucleic acid (RNA) represents a range of diverse molecules that play a crucial role in many cellular processes. From serving as a protein template to regulating genes, the complex processes involving RNA make it a focal point of study for many scientists. This article will spotlight various methods scientists have developed to investigate different RNA subtypes and the broader transcriptome.
Whole Transcriptome RNA-seq
Whole transcriptome sequencing...-
Channel: Articles
08-31-2023, 11:07 AM -
ad_right_rmr
Collapse
News
Collapse
Topics | Statistics | Last Post | ||
---|---|---|---|---|
Multiplexed Biomarker Detection with Nanopore Technology: A Leap in Precision Diagnostics
by seqadmin
Started by seqadmin, Today, 07:42 AM
|
0 responses
10 views
0 likes
|
Last Post
by seqadmin
Today, 07:42 AM
|
||
Started by seqadmin, 09-22-2023, 09:05 AM
|
0 responses
23 views
0 likes
|
Last Post
by seqadmin
09-22-2023, 09:05 AM
|
||
Started by seqadmin, 09-21-2023, 06:18 AM
|
0 responses
16 views
0 likes
|
Last Post
by seqadmin
09-21-2023, 06:18 AM
|
||
Started by seqadmin, 09-20-2023, 09:17 AM
|
0 responses
16 views
0 likes
|
Last Post
by seqadmin
09-20-2023, 09:17 AM
|
Comment