No idea; those commands should be equivalent, unless the adapters.fa file is different. Can you post the full output of the command so I can see where the bases were lost? Also, you may want to add "stats=stats.txt" which will indicate which adapter sequences are being hit, and should be identical in both cases.
Seqanswers Leaderboard Ad
Collapse
Announcement
Collapse
No announcement yet.
X
-
re: different results from command line and geneious plugin
Yes, the adapters files are different. Geneious says using All Truseq, Nextera, and PhiX adapters (152) sequences. The count in the resources folder of bbmap is 154 sequences. I don't know which 2 are lacking from geneious, presuming the shared set is 152. I could not find the adapters file geneious is calling... or the stats.txt file I asked it to produce. May need to call in Geneious support to help with this. Among the top stats.txt hits in the linux output are pcr dimer (16% of reads) and pcr primers (15% of reads). I wonder if these are lacking in geneious... Geneious is trimming more sequences by overlap 206,591 vs 157,344 and fewer sequences by ktrim 2,630,578 vs 2,657,654. Now... which one is best? The one trimming more?
Comment
-
Probably the one trimming more is better. Geneious is probably trimming more by overlap because overlap trimming happens after adapter-sequence trimming, so if some adapter sequences are missing, those will (usually) get overlap-trimmed rather than sequence-trimmed. But it's hard to say. You could align the first 1m reads to the reference (if you have one) and look at the mapping rates and error rates to see which dataset is better.
Comment
-
Hi Brian,
I'm trying to do some trimming of primer sequences from amplicons that I sequenced.
I have a viral genome that was amplified in 5 large-ish overlapping pieces (~2-3kb) and then fragmented and sequenced on a nextseq (1x150 SE).
I would like to trim only the primer sequences on the end of the read. The problem is I have primers of all different lengths, how would you go about encompassing all of the primers in one round of bbduk trimming? Or would you have to do them individually for each k value?
I was thinking something like this
Code:bbduk.sh in=$f1 out=${file_base}_ff.fq.gz literal=AGTTGTTAGTCTACGTGGA,AGCTGGAAAAACAAAGAACT,GCCAAGAAACAGGATGTCGTTG,GCCGTAATTGGTATCGATACTGGA,GGACATGGGCAGATTGAC,ACTGTGAGGATGGCTATGA,GCAGACAGAAAGTGGTGTTTT,ACAAAACGTGGGCTTACCATG,AGGCCTAACAAAAGGAGGAC,TTTCCCAGCGTCAATATGCT ktrim=l k=24 mink=15 hdist=2 qtrim=rl trimq=30 restrictleft
Thanks in advance.
Comment
-
Since you have 5 different overlapping sections, if you trim the primers all at once with no precautions, you will break your assembly into 5 segments since anything read overlapping a primer region will have the primer region trimmed. You can mostly eliminate this effect, though, using the "restrictleft" flag as in your command, but you need to specify a position - in this case, "restrictleft=24" or maybe slightly more if there is some uncertainty about where, exactly, sequencing starts on the amplification primer (restrictleft=26 should be fine).
With that change, I think your command will be fine. And certainly the most convenient. So, try it, and see if the virus assembles in one contig.
If it doesn't, you can refine it more. If you have the data split into 5 libraries with different bar codes, I'd recommend running each one independently with just its own sequences and kmer lengths. But if not, you can still get a slight increase in precision by running each primer individually with its own specific kmer length (in which case you should not do quality-trimming until after all primer-trimming is complete). You can also increase precision by turning off "rcomp" when running primers individual (since left-end primer sequences will always be the original sequence rather than reverse-complemented). You might need to play around with this a bit depending on how the sequences are reported (e.g. maybe half of the primers are already reported as reverse-complements). But those steps usually are not necessary with super-short genomes as in this case, particularly with primers that are designed to be unique in the genome; I'm just listing it as an example of what could be done if needed.
Comment
-
Brian,
Thanks for the quick response.
It seems like splitting it up does give me a little better precision (as judged by a higher % of bases lost), so I'll stick with that.
On a similar note, I'm wondering what your thoughts are on quality trimming. If I trim to q30 (qtrim=rl trimq=30) I lose about half my bases. Do you think this level of stringency is required for variant calling? What would you normally do?
Comment
-
I do not recommend extremely stringent quality-trimming prior to variant-calling (or most anything, for that matter). In general, it reduces mapping accuracy and increases various forms of bias; though the magnitude is different for a tiny nonrepetitive virus than human. Also, shorter reads reduce variant quality-score estimates and the ability to detect indels.
BBTools' callvariants.sh can do quality-trimming on mapped reads just prior to variant-calling, so the quality-trimming does not reduce mapping accuracy. The default value is 10. Additionally, the default direction is "qtrim=r" because Illumina quality scores are inaccurate on the left side (artificially low) due to the base-caller; with correctly-calibrated quality scores, though, I would use "qtrim=rl". You can, actually, recalibrate the quality scores if you want using calctruequality.sh:
Starting with the raw reads, for variant-calling on single-ended amplicon data from a NextSeq, I'd generally do this:
Code:bbduk.sh in=raw.fq out=trimmed1.fq ref=adapters.fa ktrim=r k=23 mink=11 hdist=1 minlen=150 bbmap.sh in=trimmed1.fq out=mapped_raw.sam ref=virus.fa ambig=toss slow calctruequality.sh in=mapped_raw.sam ref=virus.fa callvariants filterbytile.sh in=raw.fq out=filtered.fq clumpify.sh in=filtered.fq out=clumped.fq dedupe optical spany adjacent bbduk.sh in=clumped.fq out=recal.fq recalibrate bbduk.sh in=recal.fq out=recal_trimmed.fq ref=adapters.fa ktrim=r k=23 mink=11 hdist=1 minlen=30 (primer-trim) bbduk.sh in=primer_trimmed.fq out=qtrimmed.fq qtrim=rl trimq=8 minlen=30 bbmap.sh in=qtrimmed.fq out=mapped_final.sam ref=virus.fa callvariants.sh in=mapped_final.sam ref=virus.fa out=vars.vcf ploidy=1 (possible additional variant-calling flags like "rarity=0.05" depending on whether you are interested in minority alleles of a multi-strain viral sample)
If the virus is sufficiently divergent from the reference you can alternatively assemble the raw reads and use that assembly as "ref" for recalibration (step 2 and 3).
Comment
-
Very interesting. I like the idea of quality score recalibration. If I don't have millions of reads (only between 1000-20000x avg. coverage) can I still do all of the first steps without the filterbytile step? Will qScore recal still help me here?
Also,
"If the virus is sufficiently divergent from the reference you can alternatively assemble the raw reads and use that assembly as "ref" for recalibration (step 2 and 3)."
Do you mean use something like tadpole so de novo assemble the divergent virus and then generate a fasta file to use as a new reference?
I haven't tried clumpify's consensus feature but it would be cool if it would generate a new fasta file based on a reference as the consensus. Or is this possible already?
One other question related to variant calling. I'm using callvariants.sh and I'm noticing some variants that are clearly not real due to problems at the ends of the reads.
If I want to call variants from only the middle 60% of the read (1x150bp) is this the correct command?
callvariants.sh in=in.bam out=out.vcf ref=ref.fa minedist=30
Thanks again for your help.
Comment
-
Originally posted by jweger1988 View PostVery interesting. I like the idea of quality score recalibration. If I don't have millions of reads (only between 1000-20000x avg. coverage) can I still do all of the first steps without the filterbytile step? Will qScore recal still help me here?
Code:filterbytile.sh in=whole_flowcell.fq dump=map.flowcell filterbytile.sh in=library.fq indump=map.flowcell out=filtered.fq
"If the virus is sufficiently divergent from the reference you can alternatively assemble the raw reads and use that assembly as "ref" for recalibration (step 2 and 3)."
Do you mean use something like tadpole so de novo assemble the divergent virus and then generate a fasta file to use as a new reference?
I haven't tried Clumpify's consensus feature but it would be cool if it would generate a new fasta file based on a reference as the consensus. Or is this possible already?
One other question related to variant calling. I'm using callvariants.sh and I'm noticing some variants that are clearly not real due to problems at the ends of the reads.
If I want to call variants from only the middle 60% of the read (1x150bp) is this the correct command?
callvariants.sh in=in.bam out=out.vcf ref=ref.fa minedist=30
Thanks again for your help.
If you use the flags "out=vars.txt vcf=vars.vcf", CallVariants will also produce a tab-delimited text file that you can paste into Excel and manually look at the "edist" column to see whether it looks useful to exclude false positives. You can theoretically do that with VCF also but the tab-delimited one is much more convenient!
Comment
-
Originally posted by Brian Bushnell View PostYes, "minedist=30" should do what you want (ignore variants that are mainly near the ends of reads), but might be too aggressive. For 150bp reads the average distance of a variant from the read end should be 150/4 = 37.5, given random distribution, so maybe minedist=20 would be safer. You can alternatively yes "border=30" which will ignore the outermost 30bp of the reads and thus never consider anything in that area - that allows the whole read to be used for alignment, but only the best part in the middle to be used for variant-calling.
If you use the flags "out=vars.txt vcf=vars.vcf", CallVariants will also produce a tab-delimited text file
Comment
-
Hi Brian,
I am trying to QC sequencing library downloaded from SRA, so I do not know sequencing machine was used. It seems that BBDuk is struggling with recognition of paired reads in it and stop working without exit. So, below are detail:
These are FASTA example:
@ERR011089.1.1 I58_1_FC30DYKAAXX:8:1:3:1833 length=75
CTTCGGAAGACATTTCTTCAGAAAGTTTTTGGAGAAGATTTTTTAACGAAACCTATGGAGCGGGCTCAGCAGGAT
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII(IIIIIIIIIIIIIIIIIDIIIII.I
@ERR011089.1.2 I58_1_FC30DYKAAXX:8:1:3:1833 length=75
CTGTCAAATCCNNTTTATCCATATTCTCCATAATGTAAAGCTTCACTTCATTCAAAAATGCCAGATTGGCATCCT
+
IIIIIIIIIII!!IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@ERR011089.2.1 I58_1_FC30DYKAAXX:8:1:3:377 length=75
CGGCCAACCTCGTCGTCACGGACTACGCCTTCTCGCCCGACGAACGGCAGATACTCATCGCCTCGGGCGCCAGGC
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII'III
@ERR011089.2.2 I58_1_FC30DYKAAXX:8:1:3:377 length=75
GGCGTCGCGCGNNGCTTCGGCCTCGCGGAGTATGGGCATCAGACTGTTGCCCGAGGCCAGGAAATAATCGGTCGC
+
IIIIIIIIIII!!IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII)IIIIIIIIIIII&II%
And this is BBDuk message:
BBDuk version 36.64
Set INTERLEAVED to true
Reset INTERLEAVED to false because paired input files were specified.
Initial:
Memory: max=102900m, free=99142m, used=3758m
Added 134628693 kmers; time: 37.045 seconds.
Memory: max=102900m, free=83248m, used=19652m
Input is being processed as paired
Started output streams: 0.239 seconds.
Exception in thread "Thread-16" java.lang.AssertionError:
There appear to be different numbers of reads in the paired input files.
The pairing may have been corrupted by an upstream process. It may be fixable by running repair.sh.
at stream.ConcurrentGenericReadInputStream.pair(ConcurrentGenericReadInputStream.java:480)
at stream.ConcurrentGenericReadInputStream.readLists(ConcurrentGenericReadInputStream.java:345)
at stream.ConcurrentGenericReadInputStream.run(ConcurrentGenericReadInputStream.java:189)
at java.lang.Thread.run(Thread.java:748)
I also tried as suggested repair.sh, it cannot fix the problem with reads as well.
So I would be grateful for help with this situation. At least may it is possible to change code somehow to push program exit in case of such crash.
Ksenia
Comment
-
Hi Ksenia,
This is always a tricky problem when people rename the reads. However, it looks like in your case the file is interleaved (that's my guess from the read headers), and thus you should only be using a single input to bbduk and add the "interleaved" flag, but it seems you are giving it two input files. Can you post the bbduk command, and explain exactly what came out of the SRA extraction process? Also, posting the SRA extraction command you use might help (it won't help me, but it might mean something to somebody).
Comment
-
Thank you Brian for swift reply!
Yes, you are right, I used reads files separated, not interleaved. Here is my SRA download command:
/sratoolkit.2.8.2-1-ubuntu64/bin/fastq-dump --gzip --skip-technical --readids --dumpbase --split-files --clip "$NAME"
And my BBDuk command:
bbduk.sh -Xmx100g in="$NAME"_1.fastq.gz in2="$NAME"_2.fastq.gz ref=/home/ksenia/ksenia2/Programms/bbmap/resources/adapters.fa,/home/ksenia/ksenia2/Programms/bbmap/resources/phix174_ill.ref.fa.gz out="$ID"_filtered.fastq interleaved=t fastawrap=10000 ktrim=r qtrim=rl minlength=30 maq=10 maxns=0 overwrite=t entropy=0.5 outs="$ID"_singletons.fastq tpe=t
I am quite sure in both these commands as for several hundred libraries they worked perfectly, but for several similar libraries, example of fastq I showed BBDuk failed. But it doesn't crash and exit, BBDuk just freeze and hang the whole pipeline.
These are examples of true input files:
reads1:
@ERR011090.1.1 I328_1_FC30MD2AAXX:3:1:3:296 length=75
TGCCTATCTCATGTGGATTTATGCCATTTTTCTTCATAAGTCTATCAACCAACAATCTGCCCCATNCATCNGNCA
+ERR011090.1.1 I328_1_FC30MD2AAXX:3:1:3:296 length=75
IIIIIIIIIIIIIIIIIIIIIIIIIHIIIIHIIII@II<I7I>GDIC=@7<A0/60C<,A2;93%"E/+2"+"65
@ERR011090.2.1 I328_1_FC30MD2AAXX:3:1:3:894 length=75
TAGGCTATAAATTGTTTTTAGCGGTTGAAACAGGAATTTTCATTACGGCAGGGACACTCCCCTTTNTTTTNTNTT
+ERR011090.2.1 I328_1_FC30MD2AAXX:3:1:3:894 length=75
IIIIIIIIIIIIIIIIIIIIIIII8IH0IG/>A3F@HFIG70?A/.0,=111$,#))$+0+#$#""()$-"+"-$
reads2:
@ERR011090.1.2 I328_1_FC30MD2AAXX:3:1:3:296 length=75
ACCAAAGATAGATCCGTTTGAGGGANTTTTTGGNGTTTTTGCAGATAGTCTGCCTGATGGATGGGGCAGATTGTT
+ERR011090.1.2 I328_1_FC30MD2AAXX:3:1:3:296 length=75
IIIIIIIIIIIIIIIIIII@IIIF4"HIIIIII"I96IAII18F0B65+/5C5298-:,2,.0<57$)-%2--/.
@ERR011090.2.2 I328_1_FC30MD2AAXX:3:1:3:894 length=75
TTCAGAACGCTGTAAAAGACACACANCAAAATGNAAAAAACATAGGTCTTACTGAAAAAGACAACAAGAACAATC
+ERR011090.2.2 I328_1_FC30MD2AAXX:3:1:3:894 length=75
IIIIIIIIIIIIDIIIIIIIIBIII"IIIIIFI"IIH?II7E>?=D0;E;IBII9A;8<69:G25I5889-3812
When I tried to launch repair.sh, it can't recognise paired reads and output everything as singletons. Maybe this info also can help. BBDuk, actually, starts to produce some output as well and sort some sequences on interleaved file and singletons but at some point stops working. And I have several libraries with such problem. Any idea how this can be solved?
Comment
Latest Articles
Collapse
-
by seqadmin
Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.
Somatic Genomics
“We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...-
Channel: Articles
05-24-2024, 01:16 PM -
-
by seqadmin
The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...-
Channel: Articles
05-06-2024, 07:48 AM -
ad_right_rmr
Collapse
News
Collapse
Topics | Statistics | Last Post | ||
---|---|---|---|---|
Started by seqadmin, Today, 06:55 AM
|
0 responses
8 views
0 likes
|
Last Post
by seqadmin
Today, 06:55 AM
|
||
Started by seqadmin, 05-30-2024, 03:16 PM
|
0 responses
23 views
0 likes
|
Last Post
by seqadmin
05-30-2024, 03:16 PM
|
||
Comprehensive Sequencing of Great Ape Sex Chromosomes Yields Insights into Evolution and Genetic Variability
by seqadmin
Started by seqadmin, 05-29-2024, 01:32 PM
|
0 responses
27 views
0 likes
|
Last Post
by seqadmin
05-29-2024, 01:32 PM
|
||
Started by seqadmin, 05-24-2024, 07:15 AM
|
0 responses
214 views
0 likes
|
Last Post
by seqadmin
05-24-2024, 07:15 AM
|
Comment